Multiple sequence alignment - TraesCS2D01G230300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G230300 chr2D 100.000 3394 0 0 1 3394 200934935 200938328 0 6268
1 TraesCS2D01G230300 chr2D 97.525 3394 82 2 1 3394 604416906 604420297 0 5801
2 TraesCS2D01G230300 chr5D 98.262 3394 58 1 1 3394 562925174 562928566 0 5939
3 TraesCS2D01G230300 chr1A 98.232 3394 55 1 1 3394 94765603 94762215 0 5930
4 TraesCS2D01G230300 chr1D 98.026 3394 65 1 1 3394 185786577 185783186 0 5895
5 TraesCS2D01G230300 chr7A 97.996 3394 68 0 1 3394 211308107 211311500 0 5891
6 TraesCS2D01G230300 chr7A 97.761 3394 76 0 1 3394 563544632 563548025 0 5847
7 TraesCS2D01G230300 chr6D 98.345 3324 55 0 71 3394 458889921 458893244 0 5834


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G230300 chr2D 200934935 200938328 3393 False 6268 6268 100.000 1 3394 1 chr2D.!!$F1 3393
1 TraesCS2D01G230300 chr2D 604416906 604420297 3391 False 5801 5801 97.525 1 3394 1 chr2D.!!$F2 3393
2 TraesCS2D01G230300 chr5D 562925174 562928566 3392 False 5939 5939 98.262 1 3394 1 chr5D.!!$F1 3393
3 TraesCS2D01G230300 chr1A 94762215 94765603 3388 True 5930 5930 98.232 1 3394 1 chr1A.!!$R1 3393
4 TraesCS2D01G230300 chr1D 185783186 185786577 3391 True 5895 5895 98.026 1 3394 1 chr1D.!!$R1 3393
5 TraesCS2D01G230300 chr7A 211308107 211311500 3393 False 5891 5891 97.996 1 3394 1 chr7A.!!$F1 3393
6 TraesCS2D01G230300 chr7A 563544632 563548025 3393 False 5847 5847 97.761 1 3394 1 chr7A.!!$F2 3393
7 TraesCS2D01G230300 chr6D 458889921 458893244 3323 False 5834 5834 98.345 71 3394 1 chr6D.!!$F1 3323

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
134 135 2.422479 CGCGGCTATCCTGCTAATACTA 59.578 50.000 0.0 0.0 32.35 1.82 F
948 949 3.893813 TCTAGTTTTCCCGCCCTATCTAC 59.106 47.826 0.0 0.0 0.00 2.59 F
1600 1602 4.270834 TCTACTAGTCATCGCCTTTGAGT 58.729 43.478 0.0 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1480 1482 0.934496 TGCCGACTTTGAACGAACTG 59.066 50.000 0.0 0.0 0.00 3.16 R
1826 1828 1.474077 CCAAGCCCTGCTACAATTCAC 59.526 52.381 0.0 0.0 38.25 3.18 R
2452 2454 3.704566 TCCAGTACAGCTAATCCGTGAAT 59.295 43.478 0.0 0.0 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 4.724399 TCCTTGACAAAATAGTCTTGGCA 58.276 39.130 0.00 0.0 40.08 4.92
134 135 2.422479 CGCGGCTATCCTGCTAATACTA 59.578 50.000 0.00 0.0 32.35 1.82
326 327 4.220821 TGGTAGAACTCCAAGACAGATGAC 59.779 45.833 0.00 0.0 31.50 3.06
948 949 3.893813 TCTAGTTTTCCCGCCCTATCTAC 59.106 47.826 0.00 0.0 0.00 2.59
1046 1047 7.599245 ACGCTCTTCTGCTTATATTATTACCAC 59.401 37.037 0.00 0.0 0.00 4.16
1404 1406 6.016610 CCGCTCTTTCTATAAGCTAAGAGAGT 60.017 42.308 20.79 0.0 43.92 3.24
1600 1602 4.270834 TCTACTAGTCATCGCCTTTGAGT 58.729 43.478 0.00 0.0 0.00 3.41
1807 1809 9.912634 CCTGAAGCAAACTATGAAAAAGAAATA 57.087 29.630 0.00 0.0 0.00 1.40
1826 1828 4.870123 ATATAGCAGTCTCTTCCAGCAG 57.130 45.455 0.00 0.0 0.00 4.24
1967 1969 6.338146 TCAGACGCTATAGCTGTGTAAAAAT 58.662 36.000 21.98 0.0 39.32 1.82
2217 2219 1.134788 AGGAAGGATTTCGTACTGCCG 60.135 52.381 0.00 0.0 34.95 5.69
2452 2454 5.648178 TTTGACAGTACGATGGTTAGCTA 57.352 39.130 0.00 0.0 0.00 3.32
2610 2612 3.001414 GCGTTAGAGAAAGGAAAGGACC 58.999 50.000 0.00 0.0 0.00 4.46
3183 3185 9.528018 CTTCTTCCTTAGTTCTTTATAGCTCTG 57.472 37.037 0.00 0.0 0.00 3.35
3278 3280 6.241207 TCAAGAAAGTATCGGAAAGCAAAG 57.759 37.500 0.00 0.0 0.00 2.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 2.664402 ACCTCATGTCTTTGGTTGCT 57.336 45.000 0.00 0.00 0.00 3.91
219 220 7.439655 GCAAATAGGAAGGTACACAGAGATTAG 59.560 40.741 0.00 0.00 0.00 1.73
1046 1047 8.251026 TGCTATGAATAACCCAGTATCGAATAG 58.749 37.037 0.00 0.00 0.00 1.73
1404 1406 3.067833 TGAACAACCGATTATGCGACAA 58.932 40.909 0.00 0.00 0.00 3.18
1480 1482 0.934496 TGCCGACTTTGAACGAACTG 59.066 50.000 0.00 0.00 0.00 3.16
1600 1602 3.831911 CTCAGGGTAAATGCTTTTCCCAA 59.168 43.478 22.78 14.77 35.92 4.12
1807 1809 2.168106 CACTGCTGGAAGAGACTGCTAT 59.832 50.000 0.00 0.00 34.07 2.97
1826 1828 1.474077 CCAAGCCCTGCTACAATTCAC 59.526 52.381 0.00 0.00 38.25 3.18
2046 2048 9.747293 GTCAAGAGTTACTAAAGTAGTTTGTCT 57.253 33.333 5.77 0.00 40.14 3.41
2217 2219 4.261114 GCTTCCTTCTATCAAGAGCATTGC 60.261 45.833 0.00 0.00 31.96 3.56
2452 2454 3.704566 TCCAGTACAGCTAATCCGTGAAT 59.295 43.478 0.00 0.00 0.00 2.57
2610 2612 4.663636 GTTGTAAATCAACGGACCTCAG 57.336 45.455 0.00 0.00 45.23 3.35
2621 2623 6.189677 CGGAGCTTTATTGGTTGTAAATCA 57.810 37.500 0.00 0.00 33.18 2.57
2661 2663 4.706962 GGTCCTTCAAATGCCTATCTGTTT 59.293 41.667 0.00 0.00 0.00 2.83
2756 2758 8.206867 AGCATTGTATCTATCTTTTGCAGTCTA 58.793 33.333 0.00 0.00 0.00 2.59
3183 3185 5.057149 TGCAAAGAGTCTAAAAGAGGTGAC 58.943 41.667 0.00 0.00 0.00 3.67
3339 3341 5.651576 TCCGTTAACTTGGGTTTTGTTTACT 59.348 36.000 3.71 0.00 36.92 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.