Multiple sequence alignment - TraesCS2D01G228400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G228400 chr2D 100.000 2486 0 0 1 2486 196966758 196964273 0 4591
1 TraesCS2D01G228400 chr2D 98.034 2493 42 3 1 2486 630266208 630268700 0 4325
2 TraesCS2D01G228400 chr2D 97.394 2494 54 6 1 2486 272804677 272802187 0 4235
3 TraesCS2D01G228400 chr3A 97.270 2491 63 4 1 2486 672881449 672878959 0 4218
4 TraesCS2D01G228400 chr7B 97.120 2500 56 6 1 2486 662734495 662736992 0 4204
5 TraesCS2D01G228400 chr3B 97.081 2501 56 6 1 2486 201563800 201561302 0 4198
6 TraesCS2D01G228400 chr1B 96.680 2500 68 5 1 2486 633731890 633729392 0 4143
7 TraesCS2D01G228400 chr5B 96.267 2491 80 10 2 2486 432873713 432876196 0 4072


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G228400 chr2D 196964273 196966758 2485 True 4591 4591 100.000 1 2486 1 chr2D.!!$R1 2485
1 TraesCS2D01G228400 chr2D 630266208 630268700 2492 False 4325 4325 98.034 1 2486 1 chr2D.!!$F1 2485
2 TraesCS2D01G228400 chr2D 272802187 272804677 2490 True 4235 4235 97.394 1 2486 1 chr2D.!!$R2 2485
3 TraesCS2D01G228400 chr3A 672878959 672881449 2490 True 4218 4218 97.270 1 2486 1 chr3A.!!$R1 2485
4 TraesCS2D01G228400 chr7B 662734495 662736992 2497 False 4204 4204 97.120 1 2486 1 chr7B.!!$F1 2485
5 TraesCS2D01G228400 chr3B 201561302 201563800 2498 True 4198 4198 97.081 1 2486 1 chr3B.!!$R1 2485
6 TraesCS2D01G228400 chr1B 633729392 633731890 2498 True 4143 4143 96.680 1 2486 1 chr1B.!!$R1 2485
7 TraesCS2D01G228400 chr5B 432873713 432876196 2483 False 4072 4072 96.267 2 2486 1 chr5B.!!$F1 2484

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
184 185 2.990740 TGGCTTGGACCTTTTATGGT 57.009 45.000 0.00 0.0 44.10 3.55 F
328 329 3.055385 GCCGCCAATCTACCTTATGGATA 60.055 47.826 0.81 0.0 34.82 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1474 1478 1.440893 CAGCAGCTCATAGACCGCT 59.559 57.895 0.0 0.0 0.0 5.52 R
2035 2045 5.104109 TGGGAAAATACTCTGGATCGGAATT 60.104 40.000 0.0 0.0 0.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 185 2.990740 TGGCTTGGACCTTTTATGGT 57.009 45.000 0.00 0.00 44.10 3.55
191 192 4.235079 TGGACCTTTTATGGTGGATCTG 57.765 45.455 0.00 0.00 41.00 2.90
328 329 3.055385 GCCGCCAATCTACCTTATGGATA 60.055 47.826 0.81 0.00 34.82 2.59
459 460 5.123344 GGTTTTATTAGCGGAGAAGAAGCAA 59.877 40.000 0.00 0.00 0.00 3.91
517 518 6.581388 TTCTGGAATACAATGGGATCTTCT 57.419 37.500 0.00 0.00 0.00 2.85
651 652 8.937634 ATCCATCAAAATAATTCAACAAGCTC 57.062 30.769 0.00 0.00 0.00 4.09
652 653 7.028962 TCCATCAAAATAATTCAACAAGCTCG 58.971 34.615 0.00 0.00 0.00 5.03
1177 1181 6.701841 AGAAATATCTGCGTCGATACAACAAT 59.298 34.615 0.00 0.00 33.59 2.71
1238 1242 4.769488 TCAAGCTATAGCAGATGGGACTAG 59.231 45.833 26.07 0.00 45.16 2.57
1541 1545 6.074356 CCATTAACTTTTTGTGTGCTAGCAAC 60.074 38.462 21.29 19.03 0.00 4.17
1671 1675 7.986085 AGCTATATGAGTGAAACAAAACAGT 57.014 32.000 0.00 0.00 41.43 3.55
1988 1998 7.771826 AGATTTTTGCCCATAAAAGGAATCATG 59.228 33.333 0.00 0.00 31.80 3.07
1996 2006 7.094032 GCCCATAAAAGGAATCATGATAAGGAG 60.094 40.741 9.04 0.00 0.00 3.69
2000 2010 7.651027 AAAAGGAATCATGATAAGGAGTTGG 57.349 36.000 9.04 0.00 0.00 3.77
2067 2077 6.552008 TCCAGAGTATTTTCCCATTCACTTT 58.448 36.000 0.00 0.00 0.00 2.66
2108 2118 8.220755 TCAAGAATGAATTAACCCTTTATCCG 57.779 34.615 0.00 0.00 30.99 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 185 3.002583 TCTGTGCGCCCAGATCCA 61.003 61.111 19.05 0.0 36.57 3.41
191 192 1.172812 AAAAAGGAGTCTGTGCGCCC 61.173 55.000 4.18 0.0 0.00 6.13
459 460 3.499745 GGTCCCGATAAGCCCCAATTTAT 60.500 47.826 0.00 0.0 0.00 1.40
569 570 6.019108 AGCTAATGAATCCCCTTCTTTTTGT 58.981 36.000 0.00 0.0 34.23 2.83
1084 1088 3.010250 AGGAGGGTCAAAATGGGTAGAAC 59.990 47.826 0.00 0.0 0.00 3.01
1177 1181 4.717877 CCAGCATATTCAGGACCAATACA 58.282 43.478 0.00 0.0 0.00 2.29
1238 1242 9.723447 GCAGAATATCTTCTTTAAAAAGTAGCC 57.277 33.333 2.58 0.0 39.78 3.93
1474 1478 1.440893 CAGCAGCTCATAGACCGCT 59.559 57.895 0.00 0.0 0.00 5.52
1541 1545 6.864560 TTTAACGAATCACACGTAGAGATG 57.135 37.500 0.00 0.0 43.16 2.90
2035 2045 5.104109 TGGGAAAATACTCTGGATCGGAATT 60.104 40.000 0.00 0.0 0.00 2.17
2053 2063 7.936301 CCATTTCCTTAAAAAGTGAATGGGAAA 59.064 33.333 16.12 0.0 41.04 3.13
2067 2077 8.821686 TCATTCTTGATAGCCATTTCCTTAAA 57.178 30.769 0.00 0.0 0.00 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.