Multiple sequence alignment - TraesCS2D01G223200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G223200 chr2D 100.000 2562 0 0 1 2562 190327646 190325085 0.000000e+00 4732.0
1 TraesCS2D01G223200 chr2D 90.613 1534 118 17 577 2101 190214161 190212645 0.000000e+00 2012.0
2 TraesCS2D01G223200 chr2B 97.620 2563 59 2 1 2562 247364574 247362013 0.000000e+00 4394.0
3 TraesCS2D01G223200 chr2B 90.970 1351 104 10 759 2100 246954044 246952703 0.000000e+00 1803.0
4 TraesCS2D01G223200 chr2B 94.805 154 8 0 577 730 246954198 246954045 9.160000e-60 241.0
5 TraesCS2D01G223200 chr2A 96.097 2357 82 6 1 2349 204817195 204814841 0.000000e+00 3834.0
6 TraesCS2D01G223200 chr2A 91.976 997 62 6 577 1570 204626066 204625085 0.000000e+00 1382.0
7 TraesCS2D01G223200 chr2A 97.541 122 2 1 2442 2562 204814842 204814721 9.290000e-50 207.0
8 TraesCS2D01G223200 chr2A 94.737 38 1 1 2440 2476 685410212 685410249 9.900000e-05 58.4
9 TraesCS2D01G223200 chr7D 85.766 555 70 5 3 551 237620639 237621190 1.710000e-161 579.0
10 TraesCS2D01G223200 chr7D 94.737 38 1 1 2441 2478 76534906 76534870 9.900000e-05 58.4
11 TraesCS2D01G223200 chr5D 85.560 554 75 2 2 551 515335509 515336061 2.210000e-160 575.0
12 TraesCS2D01G223200 chr3B 85.009 547 76 4 10 551 414824817 414825362 3.730000e-153 551.0
13 TraesCS2D01G223200 chr7B 84.353 556 81 3 1 551 215011662 215012216 8.060000e-150 540.0
14 TraesCS2D01G223200 chr7A 84.258 559 77 7 3 551 557562687 557563244 3.750000e-148 534.0
15 TraesCS2D01G223200 chr7A 100.000 33 0 0 2443 2475 102495523 102495555 7.650000e-06 62.1
16 TraesCS2D01G223200 chr6B 84.107 560 70 5 1 556 705781301 705780757 8.120000e-145 523.0
17 TraesCS2D01G223200 chr1A 83.633 556 77 11 1 551 531557981 531558527 6.320000e-141 510.0
18 TraesCS2D01G223200 chr3D 100.000 33 0 0 2443 2475 601113895 601113863 7.650000e-06 62.1
19 TraesCS2D01G223200 chr1B 100.000 33 0 0 2443 2475 652257132 652257164 7.650000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G223200 chr2D 190325085 190327646 2561 True 4732.0 4732 100.0000 1 2562 1 chr2D.!!$R2 2561
1 TraesCS2D01G223200 chr2D 190212645 190214161 1516 True 2012.0 2012 90.6130 577 2101 1 chr2D.!!$R1 1524
2 TraesCS2D01G223200 chr2B 247362013 247364574 2561 True 4394.0 4394 97.6200 1 2562 1 chr2B.!!$R1 2561
3 TraesCS2D01G223200 chr2B 246952703 246954198 1495 True 1022.0 1803 92.8875 577 2100 2 chr2B.!!$R2 1523
4 TraesCS2D01G223200 chr2A 204814721 204817195 2474 True 2020.5 3834 96.8190 1 2562 2 chr2A.!!$R2 2561
5 TraesCS2D01G223200 chr2A 204625085 204626066 981 True 1382.0 1382 91.9760 577 1570 1 chr2A.!!$R1 993
6 TraesCS2D01G223200 chr7D 237620639 237621190 551 False 579.0 579 85.7660 3 551 1 chr7D.!!$F1 548
7 TraesCS2D01G223200 chr5D 515335509 515336061 552 False 575.0 575 85.5600 2 551 1 chr5D.!!$F1 549
8 TraesCS2D01G223200 chr3B 414824817 414825362 545 False 551.0 551 85.0090 10 551 1 chr3B.!!$F1 541
9 TraesCS2D01G223200 chr7B 215011662 215012216 554 False 540.0 540 84.3530 1 551 1 chr7B.!!$F1 550
10 TraesCS2D01G223200 chr7A 557562687 557563244 557 False 534.0 534 84.2580 3 551 1 chr7A.!!$F2 548
11 TraesCS2D01G223200 chr6B 705780757 705781301 544 True 523.0 523 84.1070 1 556 1 chr6B.!!$R1 555
12 TraesCS2D01G223200 chr1A 531557981 531558527 546 False 510.0 510 83.6330 1 551 1 chr1A.!!$F1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
76 77 0.474854 TAGCCCACCTTGGTCCTTCA 60.475 55.0 0.0 0.0 35.17 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1858 1886 1.263356 TCAGGTTTAGGTCCAGTCCG 58.737 55.0 0.0 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 0.474854 TAGCCCACCTTGGTCCTTCA 60.475 55.000 0.00 0.00 35.17 3.02
334 341 7.252612 TCAATACACTTCCACTCCTTATTGA 57.747 36.000 0.00 0.00 33.95 2.57
491 507 9.942850 AAAATTGATCTTTAATCCCGACAATTT 57.057 25.926 0.00 0.00 43.52 1.82
553 573 6.270815 CCAGATCATGTTCCATGAAAATGAC 58.729 40.000 10.96 6.64 45.41 3.06
849 872 4.709397 TCTTAATATGTGTTGGGGCCAAAG 59.291 41.667 4.39 0.00 37.70 2.77
966 990 3.877508 GTGCATATAGGTGTGAAGTTCCC 59.122 47.826 0.00 0.00 0.00 3.97
1039 1063 6.201226 TGTTGGCATTCGAAAAATATGCTA 57.799 33.333 17.47 10.81 43.17 3.49
1268 1294 2.364002 GAGAGCCCTAGGTCAAGTGATC 59.636 54.545 8.29 0.00 43.21 2.92
1775 1803 6.393990 GCTGTTATCACGATGAGAGGATTAT 58.606 40.000 0.00 0.00 0.00 1.28
1858 1886 9.194271 CTTTAGTAAACTTTCAGTAGGTCACTC 57.806 37.037 0.00 0.00 34.26 3.51
1867 1895 0.810016 GTAGGTCACTCGGACTGGAC 59.190 60.000 0.00 0.00 46.16 4.02
1898 1926 5.610398 TGATCAATTATAGGCACGTCATGT 58.390 37.500 0.00 0.00 0.00 3.21
2116 2149 7.151999 TGTCATTTACATAAACACCCATGAC 57.848 36.000 0.00 0.00 32.54 3.06
2193 2226 0.251121 TACGACCGTGGGACTGGTTA 60.251 55.000 5.20 0.00 38.99 2.85
2279 2312 8.906867 TGCAAATTCTATGGAAGGAAAGAATAG 58.093 33.333 0.00 0.00 37.63 1.73
2392 2425 1.304381 TTGCCTCCTTGACCATGCC 60.304 57.895 0.00 0.00 0.00 4.40
2401 2434 1.836999 TTGACCATGCCTGCTACCGT 61.837 55.000 0.00 0.00 0.00 4.83
2403 2436 0.177141 GACCATGCCTGCTACCGTAA 59.823 55.000 0.00 0.00 0.00 3.18
2408 2441 0.668096 TGCCTGCTACCGTAACAACG 60.668 55.000 0.00 0.00 0.00 4.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 7.076446 ACCAAGTGGGATATTATCTGTAGACT 58.924 38.462 1.69 0.00 41.15 3.24
553 573 8.950210 AGAACCAATAAACATACATGAACTCTG 58.050 33.333 0.00 0.00 0.00 3.35
849 872 5.663456 TCAATGATTGATAAGCTTTTGGGC 58.337 37.500 3.20 0.00 34.08 5.36
966 990 6.257849 TCCCATTTTGAATAATCTCTTCGTCG 59.742 38.462 0.00 0.00 0.00 5.12
1039 1063 7.091443 CAGACCGTGAGATTAGTACTTCTTTT 58.909 38.462 0.00 0.00 0.00 2.27
1268 1294 1.815003 GAAGAACAATGCCACTCTGGG 59.185 52.381 0.00 0.00 38.19 4.45
1469 1496 6.150809 GGATGCCTTAGATCATCAAATCCTTC 59.849 42.308 13.33 0.00 40.50 3.46
1858 1886 1.263356 TCAGGTTTAGGTCCAGTCCG 58.737 55.000 0.00 0.00 0.00 4.79
1867 1895 6.147821 CGTGCCTATAATTGATCAGGTTTAGG 59.852 42.308 14.66 14.66 0.00 2.69
1898 1926 2.608506 CCGTCGTAAGTCATTGGTGTCA 60.609 50.000 0.00 0.00 39.48 3.58
2086 2119 7.554835 TGGGTGTTTATGTAAATGACATCTACC 59.445 37.037 0.00 0.00 46.33 3.18
2112 2145 9.887629 GATCATAAATCAGGAGATACATGTCAT 57.112 33.333 0.00 0.00 33.08 3.06
2116 2149 7.859540 AGGGATCATAAATCAGGAGATACATG 58.140 38.462 0.00 0.00 33.08 3.21
2193 2226 4.074526 AGACGCGCTGATGCCAGT 62.075 61.111 5.73 0.00 42.35 4.00
2279 2312 8.705048 TTGTTGGTTTTTGGTTATACTCAAAC 57.295 30.769 0.00 0.00 33.29 2.93
2371 2404 1.002134 ATGGTCAAGGAGGCAACGG 60.002 57.895 0.00 0.00 46.39 4.44
2401 2434 3.029320 ACAAGTATCACGCCGTTGTTA 57.971 42.857 0.00 0.00 0.00 2.41
2403 2436 1.529438 CAACAAGTATCACGCCGTTGT 59.471 47.619 0.00 0.00 32.75 3.32
2408 2441 3.002862 TGTTTGACAACAAGTATCACGCC 59.997 43.478 0.00 0.00 40.10 5.68
2485 2519 5.118990 TGGCATATCTACTGCAAGAGAAAC 58.881 41.667 1.57 0.00 41.47 2.78
2493 2527 4.141642 ACACATTCTGGCATATCTACTGCA 60.142 41.667 0.00 0.00 41.47 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.