Multiple sequence alignment - TraesCS2D01G210200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G210200 chr2D 100.000 2598 0 0 1 2598 166120213 166117616 0 4798
1 TraesCS2D01G210200 chr2D 98.082 1616 31 0 983 2598 299358586 299360201 0 2813
2 TraesCS2D01G210200 chr2D 99.289 984 6 1 1 983 166128546 166127563 0 1777
3 TraesCS2D01G210200 chr6D 98.886 1616 16 2 983 2598 83547662 83546049 0 2883
4 TraesCS2D01G210200 chr6D 98.274 1622 22 1 983 2598 102997088 102998709 0 2835
5 TraesCS2D01G210200 chr6D 98.271 983 16 1 1 982 229454793 229453811 0 1720
6 TraesCS2D01G210200 chr6D 98.171 984 17 1 1 983 229463498 229462515 0 1716
7 TraesCS2D01G210200 chr6D 98.171 984 17 1 1 983 414735624 414736607 0 1716
8 TraesCS2D01G210200 chr7D 98.397 1622 20 1 983 2598 613113788 613115409 0 2846
9 TraesCS2D01G210200 chr5D 98.266 1615 26 1 983 2597 552396156 552397768 0 2826
10 TraesCS2D01G210200 chr5D 97.896 1616 34 0 983 2598 75735289 75733674 0 2796
11 TraesCS2D01G210200 chr5D 98.576 983 13 1 1 982 58042114 58041132 0 1736
12 TraesCS2D01G210200 chr5D 98.272 984 14 2 1 983 58050843 58049862 0 1720
13 TraesCS2D01G210200 chr3D 98.205 1616 27 1 983 2598 331068410 331070023 0 2822
14 TraesCS2D01G210200 chr3D 98.025 1620 28 1 983 2598 605516008 605517627 0 2811
15 TraesCS2D01G210200 chr3D 97.963 1620 29 1 983 2598 605495188 605496807 0 2806
16 TraesCS2D01G210200 chr3D 98.271 983 16 1 1 983 2792901 2793882 0 1720
17 TraesCS2D01G210200 chr3D 98.173 985 16 2 1 983 346084561 346083577 0 1718
18 TraesCS2D01G210200 chr4D 98.272 984 16 1 1 983 157669558 157668575 0 1722


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G210200 chr2D 166117616 166120213 2597 True 4798 4798 100.000 1 2598 1 chr2D.!!$R1 2597
1 TraesCS2D01G210200 chr2D 299358586 299360201 1615 False 2813 2813 98.082 983 2598 1 chr2D.!!$F1 1615
2 TraesCS2D01G210200 chr2D 166127563 166128546 983 True 1777 1777 99.289 1 983 1 chr2D.!!$R2 982
3 TraesCS2D01G210200 chr6D 83546049 83547662 1613 True 2883 2883 98.886 983 2598 1 chr6D.!!$R1 1615
4 TraesCS2D01G210200 chr6D 102997088 102998709 1621 False 2835 2835 98.274 983 2598 1 chr6D.!!$F1 1615
5 TraesCS2D01G210200 chr6D 229453811 229454793 982 True 1720 1720 98.271 1 982 1 chr6D.!!$R2 981
6 TraesCS2D01G210200 chr6D 229462515 229463498 983 True 1716 1716 98.171 1 983 1 chr6D.!!$R3 982
7 TraesCS2D01G210200 chr6D 414735624 414736607 983 False 1716 1716 98.171 1 983 1 chr6D.!!$F2 982
8 TraesCS2D01G210200 chr7D 613113788 613115409 1621 False 2846 2846 98.397 983 2598 1 chr7D.!!$F1 1615
9 TraesCS2D01G210200 chr5D 552396156 552397768 1612 False 2826 2826 98.266 983 2597 1 chr5D.!!$F1 1614
10 TraesCS2D01G210200 chr5D 75733674 75735289 1615 True 2796 2796 97.896 983 2598 1 chr5D.!!$R3 1615
11 TraesCS2D01G210200 chr5D 58041132 58042114 982 True 1736 1736 98.576 1 982 1 chr5D.!!$R1 981
12 TraesCS2D01G210200 chr5D 58049862 58050843 981 True 1720 1720 98.272 1 983 1 chr5D.!!$R2 982
13 TraesCS2D01G210200 chr3D 331068410 331070023 1613 False 2822 2822 98.205 983 2598 1 chr3D.!!$F2 1615
14 TraesCS2D01G210200 chr3D 605516008 605517627 1619 False 2811 2811 98.025 983 2598 1 chr3D.!!$F4 1615
15 TraesCS2D01G210200 chr3D 605495188 605496807 1619 False 2806 2806 97.963 983 2598 1 chr3D.!!$F3 1615
16 TraesCS2D01G210200 chr3D 2792901 2793882 981 False 1720 1720 98.271 1 983 1 chr3D.!!$F1 982
17 TraesCS2D01G210200 chr3D 346083577 346084561 984 True 1718 1718 98.173 1 983 1 chr3D.!!$R1 982
18 TraesCS2D01G210200 chr4D 157668575 157669558 983 True 1722 1722 98.272 1 983 1 chr4D.!!$R1 982

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
607 611 5.104652 CCTCTTTTCCCCTTTTCTATACCGA 60.105 44.000 0.00 0.00 0.0 4.69 F
1159 1163 4.623814 CCATATGGCGCCGATGAT 57.376 55.556 32.11 19.71 0.0 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1595 1605 0.249447 CGCGGGCATATCTCAACTCA 60.249 55.0 0.0 0.0 0.00 3.41 R
2066 2076 2.039348 GGTGTACCAAACCTAGAGGCAA 59.961 50.0 0.0 0.0 35.61 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 258 6.231211 AGTTGTACCTTGACCTTATGACAAG 58.769 40.000 0.00 0.00 40.12 3.16
607 611 5.104652 CCTCTTTTCCCCTTTTCTATACCGA 60.105 44.000 0.00 0.00 0.00 4.69
1159 1163 4.623814 CCATATGGCGCCGATGAT 57.376 55.556 32.11 19.71 0.00 2.45
1595 1605 7.336931 ACATACGATGGCTTCTTGAAAATACTT 59.663 33.333 0.00 0.00 33.60 2.24
1614 1624 0.249447 TGAGTTGAGATATGCCCGCG 60.249 55.000 0.00 0.00 0.00 6.46
1646 1656 6.581388 ATGAGGATATTCTTGAAGAACCCA 57.419 37.500 10.18 7.91 37.00 4.51
1690 1700 3.261897 AGGGGAAGTACAACAGAGATGTG 59.738 47.826 0.00 0.00 32.27 3.21
2066 2076 4.955450 TGATCCCGAATTTGATGAACCATT 59.045 37.500 0.00 0.00 0.00 3.16
2078 2088 3.806949 TGAACCATTTGCCTCTAGGTT 57.193 42.857 0.00 0.00 44.69 3.50
2152 2162 8.481314 GTTCCTCATATGCTTATCTGGATGATA 58.519 37.037 0.00 0.00 36.65 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
607 611 4.029971 CCAGCATCTGGTTGCGACAATT 62.030 50.000 6.39 0.0 45.82 2.32
1595 1605 0.249447 CGCGGGCATATCTCAACTCA 60.249 55.000 0.00 0.0 0.00 3.41
1690 1700 1.338890 GGACTCCTTGCCCTACCCTC 61.339 65.000 0.00 0.0 0.00 4.30
2066 2076 2.039348 GGTGTACCAAACCTAGAGGCAA 59.961 50.000 0.00 0.0 35.61 4.52
2502 2524 3.047877 CCTTCCGTGCGTGTTCCC 61.048 66.667 0.00 0.0 0.00 3.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.