Multiple sequence alignment - TraesCS2D01G207700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G207700 chr2D 100.000 3637 0 0 1 3637 161651777 161648141 0.000000e+00 6717.0
1 TraesCS2D01G207700 chr2D 95.918 49 2 0 6 54 298539180 298539228 3.010000e-11 80.5
2 TraesCS2D01G207700 chr6D 97.616 3650 60 12 1 3637 197263428 197267063 0.000000e+00 6233.0
3 TraesCS2D01G207700 chr6D 95.769 2671 70 9 458 3091 338138091 338135427 0.000000e+00 4266.0
4 TraesCS2D01G207700 chr6D 90.223 1391 105 19 2259 3637 245496821 245498192 0.000000e+00 1786.0
5 TraesCS2D01G207700 chr6D 88.905 1388 130 12 2259 3635 245569550 245570924 0.000000e+00 1688.0
6 TraesCS2D01G207700 chr6D 96.552 435 8 1 1 428 338138524 338138090 0.000000e+00 713.0
7 TraesCS2D01G207700 chr3A 96.348 3669 93 9 1 3637 216936516 216940175 0.000000e+00 5995.0
8 TraesCS2D01G207700 chr3A 98.005 2907 50 5 1 2906 217011983 217014882 0.000000e+00 5040.0
9 TraesCS2D01G207700 chr2B 95.512 3654 141 11 1 3637 430822835 430819188 0.000000e+00 5818.0
10 TraesCS2D01G207700 chr2B 94.386 944 46 6 2700 3637 669355657 669356599 0.000000e+00 1443.0
11 TraesCS2D01G207700 chr2B 93.943 941 46 6 2700 3637 602888718 602887786 0.000000e+00 1411.0
12 TraesCS2D01G207700 chr4A 94.770 3652 164 15 1 3637 418291091 418287452 0.000000e+00 5661.0
13 TraesCS2D01G207700 chr5D 93.512 1788 89 14 426 2191 213671153 213672935 0.000000e+00 2634.0
14 TraesCS2D01G207700 chr3B 96.997 1432 29 5 1369 2789 241261625 241260197 0.000000e+00 2394.0
15 TraesCS2D01G207700 chr4B 96.853 1430 32 4 1366 2783 199721268 199722696 0.000000e+00 2379.0
16 TraesCS2D01G207700 chr4B 92.213 1053 61 9 426 1460 631901768 631902817 0.000000e+00 1471.0
17 TraesCS2D01G207700 chr4B 87.000 400 37 12 4 397 115709308 115708918 1.550000e-118 436.0
18 TraesCS2D01G207700 chr7A 94.616 1486 73 7 1818 3300 276742033 276743514 0.000000e+00 2294.0
19 TraesCS2D01G207700 chr6B 92.908 1410 71 11 426 1811 129871435 129870031 0.000000e+00 2023.0
20 TraesCS2D01G207700 chr6B 91.176 68 3 3 1 65 353096110 353096043 5.000000e-14 89.8
21 TraesCS2D01G207700 chr1A 91.529 1393 95 14 2259 3637 489151194 489152577 0.000000e+00 1897.0
22 TraesCS2D01G207700 chr1A 87.313 402 37 12 1 397 371317283 371317675 7.160000e-122 448.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G207700 chr2D 161648141 161651777 3636 True 6717.0 6717 100.0000 1 3637 1 chr2D.!!$R1 3636
1 TraesCS2D01G207700 chr6D 197263428 197267063 3635 False 6233.0 6233 97.6160 1 3637 1 chr6D.!!$F1 3636
2 TraesCS2D01G207700 chr6D 338135427 338138524 3097 True 2489.5 4266 96.1605 1 3091 2 chr6D.!!$R1 3090
3 TraesCS2D01G207700 chr6D 245496821 245498192 1371 False 1786.0 1786 90.2230 2259 3637 1 chr6D.!!$F2 1378
4 TraesCS2D01G207700 chr6D 245569550 245570924 1374 False 1688.0 1688 88.9050 2259 3635 1 chr6D.!!$F3 1376
5 TraesCS2D01G207700 chr3A 216936516 216940175 3659 False 5995.0 5995 96.3480 1 3637 1 chr3A.!!$F1 3636
6 TraesCS2D01G207700 chr3A 217011983 217014882 2899 False 5040.0 5040 98.0050 1 2906 1 chr3A.!!$F2 2905
7 TraesCS2D01G207700 chr2B 430819188 430822835 3647 True 5818.0 5818 95.5120 1 3637 1 chr2B.!!$R1 3636
8 TraesCS2D01G207700 chr2B 669355657 669356599 942 False 1443.0 1443 94.3860 2700 3637 1 chr2B.!!$F1 937
9 TraesCS2D01G207700 chr2B 602887786 602888718 932 True 1411.0 1411 93.9430 2700 3637 1 chr2B.!!$R2 937
10 TraesCS2D01G207700 chr4A 418287452 418291091 3639 True 5661.0 5661 94.7700 1 3637 1 chr4A.!!$R1 3636
11 TraesCS2D01G207700 chr5D 213671153 213672935 1782 False 2634.0 2634 93.5120 426 2191 1 chr5D.!!$F1 1765
12 TraesCS2D01G207700 chr3B 241260197 241261625 1428 True 2394.0 2394 96.9970 1369 2789 1 chr3B.!!$R1 1420
13 TraesCS2D01G207700 chr4B 199721268 199722696 1428 False 2379.0 2379 96.8530 1366 2783 1 chr4B.!!$F1 1417
14 TraesCS2D01G207700 chr4B 631901768 631902817 1049 False 1471.0 1471 92.2130 426 1460 1 chr4B.!!$F2 1034
15 TraesCS2D01G207700 chr7A 276742033 276743514 1481 False 2294.0 2294 94.6160 1818 3300 1 chr7A.!!$F1 1482
16 TraesCS2D01G207700 chr6B 129870031 129871435 1404 True 2023.0 2023 92.9080 426 1811 1 chr6B.!!$R1 1385
17 TraesCS2D01G207700 chr1A 489151194 489152577 1383 False 1897.0 1897 91.5290 2259 3637 1 chr1A.!!$F2 1378

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1052 1100 3.769201 GCAGCCAGCCTTTGTTCT 58.231 55.556 0.0 0.0 37.23 3.01 F
1316 1366 7.415541 GCCAAAATTGATGCTCTATAGTTCACA 60.416 37.037 0.0 0.0 0.00 3.58 F
2166 2234 8.434733 AACTTCACTTCTGTCTAAACCTTTAC 57.565 34.615 0.0 0.0 0.00 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1990 2057 0.768221 TGGCTGTGAGGAAGGAGGTT 60.768 55.000 0.0 0.0 0.00 3.50 R
2166 2234 4.317488 CATCTGTTTTTGAAATGGGTGGG 58.683 43.478 0.0 0.0 0.00 4.61 R
3473 3609 6.755141 AGCTATCGAAAATGCGAAACTTAGTA 59.245 34.615 0.0 0.0 44.22 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1052 1100 3.769201 GCAGCCAGCCTTTGTTCT 58.231 55.556 0.00 0.00 37.23 3.01
1316 1366 7.415541 GCCAAAATTGATGCTCTATAGTTCACA 60.416 37.037 0.00 0.00 0.00 3.58
2166 2234 8.434733 AACTTCACTTCTGTCTAAACCTTTAC 57.565 34.615 0.00 0.00 0.00 2.01
2847 2926 7.819521 AGGGGATGATCATTCATATGTCTAA 57.180 36.000 16.02 0.00 42.73 2.10
2978 3099 5.855045 AGAGTAAAGTTCGGACTGTGAAAT 58.145 37.500 0.00 0.00 35.91 2.17
3216 3346 4.030977 CCGTAGATCGTTGAAAAGTTACGG 59.969 45.833 8.03 8.03 43.97 4.02
3473 3609 5.176958 CGAAGTAGAGAAAACGTCCAACATT 59.823 40.000 0.00 0.00 0.00 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1003 1051 1.376037 GTTGGAGGCCGTCTTCAGG 60.376 63.158 0.00 0.0 31.48 3.86
1052 1100 2.184322 GGAAGGAGACGCGCATGA 59.816 61.111 5.73 0.0 0.00 3.07
1990 2057 0.768221 TGGCTGTGAGGAAGGAGGTT 60.768 55.000 0.00 0.0 0.00 3.50
2166 2234 4.317488 CATCTGTTTTTGAAATGGGTGGG 58.683 43.478 0.00 0.0 0.00 4.61
2978 3099 8.321716 GCGTTGTGTTTGTTTTTAATGATGTAA 58.678 29.630 0.00 0.0 0.00 2.41
3473 3609 6.755141 AGCTATCGAAAATGCGAAACTTAGTA 59.245 34.615 0.00 0.0 44.22 1.82
3557 3695 8.455598 ACGAATTCAAATACGGTTAAAATTGG 57.544 30.769 6.22 0.0 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.