Multiple sequence alignment - TraesCS2D01G195700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G195700 chr2D 100.000 3505 0 0 1 3505 142215746 142219250 0.000000e+00 6473.0
1 TraesCS2D01G195700 chr2D 94.810 2216 105 9 580 2789 89876608 89874397 0.000000e+00 3446.0
2 TraesCS2D01G195700 chr7D 99.088 3507 28 3 1 3505 83434210 83437714 0.000000e+00 6296.0
3 TraesCS2D01G195700 chr7D 98.688 3507 36 6 1 3505 292322336 292325834 0.000000e+00 6213.0
4 TraesCS2D01G195700 chrUn 98.945 3508 31 5 1 3505 19136072 19139576 0.000000e+00 6268.0
5 TraesCS2D01G195700 chr4D 98.756 3297 32 8 211 3505 215025841 215022552 0.000000e+00 5853.0
6 TraesCS2D01G195700 chr5A 97.248 3234 67 7 1 3217 427854486 427851258 0.000000e+00 5459.0
7 TraesCS2D01G195700 chr5A 91.304 598 16 10 1 583 65997205 65997781 0.000000e+00 784.0
8 TraesCS2D01G195700 chr6A 96.753 3234 71 8 1 3217 517540713 517537497 0.000000e+00 5360.0
9 TraesCS2D01G195700 chr4A 96.631 3235 78 9 1 3217 679660151 679656930 0.000000e+00 5341.0
10 TraesCS2D01G195700 chr4A 91.152 599 33 5 1 584 96106060 96106653 0.000000e+00 795.0
11 TraesCS2D01G195700 chr4A 90.985 599 31 8 1 584 588547953 588548543 0.000000e+00 785.0
12 TraesCS2D01G195700 chr2A 95.090 2220 97 6 580 2792 89491533 89489319 0.000000e+00 3485.0
13 TraesCS2D01G195700 chr2B 93.959 2218 121 7 580 2789 142377787 142375575 0.000000e+00 3341.0
14 TraesCS2D01G195700 chr2B 93.182 44 3 0 2783 2826 622491379 622491422 8.120000e-07 65.8
15 TraesCS2D01G195700 chr1D 96.629 1958 31 8 1556 3505 460574411 460572481 0.000000e+00 3217.0
16 TraesCS2D01G195700 chr1D 99.292 565 1 2 1 564 460574973 460574411 0.000000e+00 1018.0
17 TraesCS2D01G195700 chr3D 95.152 722 33 2 2784 3505 48644531 48645250 0.000000e+00 1138.0
18 TraesCS2D01G195700 chr3B 93.144 598 24 4 1 583 17319281 17319876 0.000000e+00 861.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G195700 chr2D 142215746 142219250 3504 False 6473.0 6473 100.0000 1 3505 1 chr2D.!!$F1 3504
1 TraesCS2D01G195700 chr2D 89874397 89876608 2211 True 3446.0 3446 94.8100 580 2789 1 chr2D.!!$R1 2209
2 TraesCS2D01G195700 chr7D 83434210 83437714 3504 False 6296.0 6296 99.0880 1 3505 1 chr7D.!!$F1 3504
3 TraesCS2D01G195700 chr7D 292322336 292325834 3498 False 6213.0 6213 98.6880 1 3505 1 chr7D.!!$F2 3504
4 TraesCS2D01G195700 chrUn 19136072 19139576 3504 False 6268.0 6268 98.9450 1 3505 1 chrUn.!!$F1 3504
5 TraesCS2D01G195700 chr4D 215022552 215025841 3289 True 5853.0 5853 98.7560 211 3505 1 chr4D.!!$R1 3294
6 TraesCS2D01G195700 chr5A 427851258 427854486 3228 True 5459.0 5459 97.2480 1 3217 1 chr5A.!!$R1 3216
7 TraesCS2D01G195700 chr5A 65997205 65997781 576 False 784.0 784 91.3040 1 583 1 chr5A.!!$F1 582
8 TraesCS2D01G195700 chr6A 517537497 517540713 3216 True 5360.0 5360 96.7530 1 3217 1 chr6A.!!$R1 3216
9 TraesCS2D01G195700 chr4A 679656930 679660151 3221 True 5341.0 5341 96.6310 1 3217 1 chr4A.!!$R1 3216
10 TraesCS2D01G195700 chr4A 96106060 96106653 593 False 795.0 795 91.1520 1 584 1 chr4A.!!$F1 583
11 TraesCS2D01G195700 chr4A 588547953 588548543 590 False 785.0 785 90.9850 1 584 1 chr4A.!!$F2 583
12 TraesCS2D01G195700 chr2A 89489319 89491533 2214 True 3485.0 3485 95.0900 580 2792 1 chr2A.!!$R1 2212
13 TraesCS2D01G195700 chr2B 142375575 142377787 2212 True 3341.0 3341 93.9590 580 2789 1 chr2B.!!$R1 2209
14 TraesCS2D01G195700 chr1D 460572481 460574973 2492 True 2117.5 3217 97.9605 1 3505 2 chr1D.!!$R1 3504
15 TraesCS2D01G195700 chr3D 48644531 48645250 719 False 1138.0 1138 95.1520 2784 3505 1 chr3D.!!$F1 721
16 TraesCS2D01G195700 chr3B 17319281 17319876 595 False 861.0 861 93.1440 1 583 1 chr3B.!!$F1 582

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1374 1394 7.232118 AGTTATTGCATTGGCTTTAACTCTT 57.768 32.0 0.0 0.0 40.83 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3175 3210 3.056607 GTGGGCTGCAACTGAATACAAAT 60.057 43.478 0.5 0.0 0.0 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1374 1394 7.232118 AGTTATTGCATTGGCTTTAACTCTT 57.768 32.000 0.00 0.0 40.83 2.85
1775 1795 1.347707 TCAGCAGAAAACCGAGGTCAT 59.652 47.619 0.00 0.0 0.00 3.06
1926 1946 9.241919 ACTATCAAATGTCATGTGTATTTTCCA 57.758 29.630 2.86 0.0 0.00 3.53
1955 1975 3.876309 ACTGGCTTTGGAGGAAAACTA 57.124 42.857 0.00 0.0 0.00 2.24
2567 2597 4.202441 CCATGCTTACTGGAACTTATGCT 58.798 43.478 0.00 0.0 35.70 3.79
2733 2768 2.751806 CAGATCTTCCTGCCCAACTTTC 59.248 50.000 0.00 0.0 0.00 2.62
3098 3133 4.097418 AGTTAGGCAGTCAACTATGGTCT 58.903 43.478 0.00 0.0 33.29 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
639 655 4.697514 CAAGATCGTACAGAATCACCCAT 58.302 43.478 0.00 0.0 0.00 4.00
973 993 8.148351 CGATAAGTAATTCTCACCCCTAATTCA 58.852 37.037 0.00 0.0 0.00 2.57
1374 1394 7.826918 AAGCCACTTGTTTACATTTAACCTA 57.173 32.000 0.00 0.0 0.00 3.08
1775 1795 4.783764 TTCAGTGAAGTCGCTATTCTCA 57.216 40.909 0.08 0.0 34.49 3.27
1955 1975 9.518906 AATTTACATTTAAAAACGACGGAACTT 57.481 25.926 0.00 0.0 30.86 2.66
2098 2118 1.103398 CGGCAGGCCCCTGAAAATAG 61.103 60.000 18.20 0.0 46.30 1.73
2099 2119 1.077068 CGGCAGGCCCCTGAAAATA 60.077 57.895 18.20 0.0 46.30 1.40
2181 2201 3.749088 CACAAATCATTGCCAGCATGTTT 59.251 39.130 0.00 0.0 40.34 2.83
2520 2548 9.874215 GGTACAAAGTACAGAAAACAAGATAAC 57.126 33.333 9.27 0.0 0.00 1.89
2733 2768 4.022068 TCTGGACAAGCAAGCAATAAAAGG 60.022 41.667 0.00 0.0 0.00 3.11
3098 3133 7.771361 TGTCATACACCTAACTTTTGAAGTCAA 59.229 33.333 0.00 0.0 41.91 3.18
3175 3210 3.056607 GTGGGCTGCAACTGAATACAAAT 60.057 43.478 0.50 0.0 0.00 2.32
3333 3371 6.503560 TCCTCTTCTGTAAAAGGGTAACAA 57.496 37.500 0.00 0.0 39.74 2.83
3389 3427 0.613012 GCAAGGGGCATCAAGAAGGT 60.613 55.000 0.00 0.0 43.97 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.