AutoCloner

Multiple sequence alignment - TraesCS2D01G187500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G187500	chr2D	100.000	3269	0	0	1	3269	131283195	131286463	0.000000e+00	6037
1	TraesCS2D01G187500	chr2D	79.713	1326	172	46	962	2256	131360129	131361388	0.000000e+00	869
2	TraesCS2D01G187500	chr2D	77.179	1021	158	44	1269	2256	131316951	131317929	2.890000e-145	525
3	TraesCS2D01G187500	chr2D	80.026	766	92	27	952	1692	131316687	131317416	8.090000e-141	510
4	TraesCS2D01G187500	chr2D	85.061	328	25	10	316	621	131292053	131292378	2.450000e-81	313
5	TraesCS2D01G187500	chr2D	81.595	326	33	16	350	649	131359442	131359766	9.060000e-61	244
6	TraesCS2D01G187500	chr2D	92.233	103	8	0	1	103	71386562	71386460	2.630000e-31	147
7	TraesCS2D01G187500	chr2D	89.744	117	7	3	1282	1397	131284413	131284525	9.450000e-31	145
8	TraesCS2D01G187500	chr2A	81.842	1162	96	28	193	1331	137935286	137936355	0.000000e+00	870
9	TraesCS2D01G187500	chr2A	84.914	696	64	20	1260	1941	137936218	137936886	0.000000e+00	665
10	TraesCS2D01G187500	chr2A	80.440	910	120	26	1045	1937	137942339	137943207	2.750000e-180	641
11	TraesCS2D01G187500	chr2A	78.092	1027	153	40	1260	2256	138084527	138085511	4.700000e-163	584
12	TraesCS2D01G187500	chr2A	79.323	827	121	26	962	1773	138084294	138085085	4.800000e-148	534
13	TraesCS2D01G187500	chr2A	77.306	965	144	40	1283	2204	137951449	137952381	1.750000e-137	499
14	TraesCS2D01G187500	chr2A	79.085	765	101	24	952	1692	137951171	137951900	3.820000e-129	472
15	TraesCS2D01G187500	chr2A	81.231	325	35	12	350	649	138083623	138083946	4.220000e-59	239
16	TraesCS2D01G187500	chr2A	80.545	257	25	11	404	636	137941613	137941868	1.210000e-39	174
17	TraesCS2D01G187500	chr2B	95.859	483	13	2	212	689	184777077	184777557	0.000000e+00	774
18	TraesCS2D01G187500	chr2B	80.935	1070	125	44	1282	2335	184877194	184878200	0.000000e+00	773
19	TraesCS2D01G187500	chr2B	92.911	395	21	5	939	1328	184789256	184789648	4.730000e-158	568
20	TraesCS2D01G187500	chr2B	91.150	339	20	4	962	1290	184930555	184930893	4.970000e-123	451
21	TraesCS2D01G187500	chr2B	76.693	901	143	40	1449	2328	184789580	184790434	3.870000e-119	438
22	TraesCS2D01G187500	chr2B	89.884	346	23	8	988	1328	184876965	184877303	5.010000e-118	435
23	TraesCS2D01G187500	chr2B	75.905	884	149	33	1260	2114	184909817	184910665	8.500000e-106	394
24	TraesCS2D01G187500	chr2B	88.308	325	35	2	1512	1833	184930902	184931226	1.420000e-103	387
25	TraesCS2D01G187500	chr2B	78.064	661	100	27	1624	2256	184800836	184801479	3.080000e-100	375
26	TraesCS2D01G187500	chr2B	85.209	311	26	14	350	641	184927767	184928076	5.300000e-78	302
27	TraesCS2D01G187500	chr2B	79.405	437	59	14	1282	1703	184789539	184789959	2.480000e-71	279
28	TraesCS2D01G187500	chr2B	89.302	215	17	1	1	215	184776786	184776994	6.950000e-67	265
29	TraesCS2D01G187500	chr2B	94.410	161	5	1	673	833	184787232	184787388	9.060000e-61	244
30	TraesCS2D01G187500	chr2B	81.061	264	30	12	404	649	184798249	184798510	3.330000e-45	193
31	TraesCS2D01G187500	chr2B	78.247	308	55	7	1500	1803	184789589	184789888	1.550000e-43	187
32	TraesCS2D01G187500	chr2B	73.861	417	58	29	1865	2256	184952259	184952649	5.730000e-23	119
33	TraesCS2D01G187500	chr2B	85.859	99	11	2	3169	3267	184882354	184882449	5.770000e-18	102
34	TraesCS2D01G187500	chr6D	92.308	104	8	0	1	104	418956996	418957099	7.310000e-32	148
35	TraesCS2D01G187500	chr6A	91.346	104	9	0	1	104	562528395	562528498	3.400000e-30	143
36	TraesCS2D01G187500	chr1B	92.079	101	8	0	1	101	174599339	174599239	3.400000e-30	143
37	TraesCS2D01G187500	chr4B	90.385	104	10	0	1	104	525268185	525268288	1.580000e-28	137
38	TraesCS2D01G187500	chr4B	90.385	104	10	0	1	104	525268467	525268364	1.580000e-28	137
39	TraesCS2D01G187500	chr4B	89.423	104	11	0	1	104	525304744	525304641	7.360000e-27	132
40	TraesCS2D01G187500	chr7D	89.423	104	11	0	1	104	11263225	11263328	7.360000e-27	132
41	TraesCS2D01G187500	chr1A	89.423	104	11	0	1	104	574541831	574541728	7.360000e-27	132

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G187500	chr2D	131283195	131286463	3268	False	3091.000000	6037	94.872000	1	3269	2	chr2D.!!$F2	3268
1	TraesCS2D01G187500	chr2D	131359442	131361388	1946	False	556.500000	869	80.654000	350	2256	2	chr2D.!!$F4	1906
2	TraesCS2D01G187500	chr2D	131316687	131317929	1242	False	517.500000	525	78.602500	952	2256	2	chr2D.!!$F3	1304
3	TraesCS2D01G187500	chr2A	137935286	137936886	1600	False	767.500000	870	83.378000	193	1941	2	chr2A.!!$F1	1748
4	TraesCS2D01G187500	chr2A	137951171	137952381	1210	False	485.500000	499	78.195500	952	2204	2	chr2A.!!$F3	1252
5	TraesCS2D01G187500	chr2A	138083623	138085511	1888	False	452.333333	584	79.548667	350	2256	3	chr2A.!!$F4	1906
6	TraesCS2D01G187500	chr2A	137941613	137943207	1594	False	407.500000	641	80.492500	404	1937	2	chr2A.!!$F2	1533
7	TraesCS2D01G187500	chr2B	184876965	184878200	1235	False	604.000000	773	85.409500	988	2335	2	chr2B.!!$F7	1347
8	TraesCS2D01G187500	chr2B	184776786	184777557	771	False	519.500000	774	92.580500	1	689	2	chr2B.!!$F4	688
9	TraesCS2D01G187500	chr2B	184909817	184910665	848	False	394.000000	394	75.905000	1260	2114	1	chr2B.!!$F2	854
10	TraesCS2D01G187500	chr2B	184927767	184931226	3459	False	380.000000	451	88.222333	350	1833	3	chr2B.!!$F8	1483
11	TraesCS2D01G187500	chr2B	184787232	184790434	3202	False	343.200000	568	84.333200	673	2328	5	chr2B.!!$F5	1655
12	TraesCS2D01G187500	chr2B	184798249	184801479	3230	False	284.000000	375	79.562500	404	2256	2	chr2B.!!$F6	1852

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
271	358	0.313672	CCAATCAACCACAACCACCG	59.686	55.0	0.00	0.0	0.00	4.94	F
790	2390	0.392729	AAACAACCACCGGTTCGTCA	60.393	50.0	2.97	0.0	43.05	4.35	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1465	6506	0.249120	TGGCACCTCTGGTACGATTG	59.751	55.0	0.0	0.0	32.11	2.67	R
2545	7932	0.028902	GCCAAGCTTTCAACGTCGTT	59.971	50.0	4.4	4.4	0.00	3.85	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
24	25	4.222589	CAATGTAGTGCGCCCGCG	62.223	66.667	4.18	4.36	45.51	6.46
48	49	4.610605	TTACGAGATCCAAGTTTGACCA	57.389	40.909	0.00	0.00	0.00	4.02
61	62	8.875168	TCCAAGTTTGACCATAAATTTAACCAT	58.125	29.630	1.21	0.00	0.00	3.55
63	64	8.859156	CAAGTTTGACCATAAATTTAACCATCG	58.141	33.333	1.21	0.00	0.00	3.84
65	66	8.798402	AGTTTGACCATAAATTTAACCATCGAA	58.202	29.630	1.21	2.25	0.00	3.71
68	69	8.343168	TGACCATAAATTTAACCATCGAAACT	57.657	30.769	1.21	0.00	0.00	2.66
78	79	2.094659	ATCGAAACTGACTGCGGCG	61.095	57.895	0.51	0.51	0.00	6.46
101	102	7.033530	CGGGAGCAAAAATTATACCAATGTA	57.966	36.000	0.00	0.00	0.00	2.29
130	131	3.825014	AGTACTAAAGAGCGAGTTGTCCA	59.175	43.478	0.00	0.00	0.00	4.02
137	138	1.153549	GCGAGTTGTCCAGCTAGGG	60.154	63.158	0.00	0.00	38.24	3.53
234	321	5.912149	ATATGCTGTCCCTAATTTCCAGA	57.088	39.130	0.00	0.00	0.00	3.86
271	358	0.313672	CCAATCAACCACAACCACCG	59.686	55.000	0.00	0.00	0.00	4.94
394	481	1.632589	GACCACAGCCCCTGAAATTT	58.367	50.000	0.00	0.00	35.18	1.82
584	714	2.095161	CGGATCGACCTAGATAGTTGCC	60.095	54.545	0.00	0.00	36.31	4.52
608	740	2.332654	GCTGCCGAACCGACCAATT	61.333	57.895	0.00	0.00	0.00	2.32
609	741	1.862602	GCTGCCGAACCGACCAATTT	61.863	55.000	0.00	0.00	0.00	1.82
783	2383	4.212636	CAGAAGTAAGTAAACAACCACCGG	59.787	45.833	0.00	0.00	0.00	5.28
784	2384	3.843893	AGTAAGTAAACAACCACCGGT	57.156	42.857	0.00	0.00	37.65	5.28
786	2386	4.129380	AGTAAGTAAACAACCACCGGTTC	58.871	43.478	2.97	0.00	43.05	3.62
787	2387	1.585297	AGTAAACAACCACCGGTTCG	58.415	50.000	2.97	0.00	43.05	3.95
788	2388	1.134431	AGTAAACAACCACCGGTTCGT	60.134	47.619	2.97	0.00	43.05	3.85
789	2389	1.261354	GTAAACAACCACCGGTTCGTC	59.739	52.381	2.97	0.00	43.05	4.20
790	2390	0.392729	AAACAACCACCGGTTCGTCA	60.393	50.000	2.97	0.00	43.05	4.35
791	2391	0.392729	AACAACCACCGGTTCGTCAA	60.393	50.000	2.97	0.00	43.05	3.18
792	2392	0.392729	ACAACCACCGGTTCGTCAAA	60.393	50.000	2.97	0.00	43.05	2.69

Showing 1 to 25 of 629 entries

Previous1 2 3 4 5…26Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
24	25	4.142881	GGTCAAACTTGGATCTCGTAAAGC	60.143	45.833	0.00	0.00	0.00	3.51
25	26	4.994852	TGGTCAAACTTGGATCTCGTAAAG	59.005	41.667	0.00	0.00	0.00	1.85
28	29	4.819105	ATGGTCAAACTTGGATCTCGTA	57.181	40.909	0.00	0.00	0.00	3.43
29	30	3.703001	ATGGTCAAACTTGGATCTCGT	57.297	42.857	0.00	0.00	0.00	4.18
48	49	7.968405	GCAGTCAGTTTCGATGGTTAAATTTAT	59.032	33.333	0.00	0.00	0.00	1.40
61	62	2.733218	CGCCGCAGTCAGTTTCGA	60.733	61.111	0.00	0.00	0.00	3.71
63	64	3.423154	CCCGCCGCAGTCAGTTTC	61.423	66.667	0.00	0.00	0.00	2.78
65	66	4.379243	CTCCCGCCGCAGTCAGTT	62.379	66.667	0.00	0.00	0.00	3.16
97	98	8.405418	TCGCTCTTTAGTACTCCATAATACAT	57.595	34.615	0.00	0.00	0.00	2.29
101	102	6.963083	ACTCGCTCTTTAGTACTCCATAAT	57.037	37.500	0.00	0.00	0.00	1.28
116	117	0.814457	CTAGCTGGACAACTCGCTCT	59.186	55.000	0.00	0.00	34.14	4.09
130	131	5.760131	AGACTATGCAAATTTTCCCTAGCT	58.240	37.500	0.00	0.00	0.00	3.32
137	138	7.649306	ACACAGACAAAGACTATGCAAATTTTC	59.351	33.333	0.00	0.00	0.00	2.29
234	321	3.698820	GGCTCCACGTAACCCGGT	61.699	66.667	0.00	0.00	42.24	5.28
374	461	0.609131	AATTTCAGGGGCTGTGGTCG	60.609	55.000	0.00	0.00	32.61	4.79
394	481	1.358725	GCGAACGGCTGATGCAAGTA	61.359	55.000	0.00	0.00	41.91	2.24
539	666	3.234353	TGATCTCCTGAAGACGCCATAT	58.766	45.455	0.00	0.00	36.65	1.78
608	740	3.088532	CTGTTTTGGGGATGATTCGGAA	58.911	45.455	0.00	0.00	0.00	4.30
609	741	2.041081	ACTGTTTTGGGGATGATTCGGA	59.959	45.455	0.00	0.00	0.00	4.55
791	2391	5.107645	GCATTTCGGCTGTTCGTTTATTTTT	60.108	36.000	0.00	0.00	0.00	1.94
792	2392	4.384547	GCATTTCGGCTGTTCGTTTATTTT	59.615	37.500	0.00	0.00	0.00	1.82
793	2393	3.917985	GCATTTCGGCTGTTCGTTTATTT	59.082	39.130	0.00	0.00	0.00	1.40
794	2394	3.057876	TGCATTTCGGCTGTTCGTTTATT	60.058	39.130	0.00	0.00	34.04	1.40
795	2395	2.486203	TGCATTTCGGCTGTTCGTTTAT	59.514	40.909	0.00	0.00	34.04	1.40
796	2396	1.874231	TGCATTTCGGCTGTTCGTTTA	59.126	42.857	0.00	0.00	34.04	2.01

Showing 1 to 25 of 632 entries

Previous1 2 3 4 5…26Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.