AutoCloner

Multiple sequence alignment - TraesCS2D01G184900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G184900	chr2D	100.000	2791	0	0	1	2791	129958142	129960932	0.000000e+00	5155.0
1	TraesCS2D01G184900	chr2D	92.025	163	13	0	2036	2198	56541150	56540988	2.160000e-56	230.0
2	TraesCS2D01G184900	chr2D	89.385	179	17	2	2017	2194	445733845	445733668	1.010000e-54	224.0
3	TraesCS2D01G184900	chr2D	88.889	180	19	1	2020	2198	305514858	305515037	1.300000e-53	220.0
4	TraesCS2D01G184900	chr2D	79.139	302	24	12	530	796	129911736	129912033	3.700000e-39	172.0
5	TraesCS2D01G184900	chr2D	82.000	200	33	3	37	235	304707434	304707237	1.720000e-37	167.0
6	TraesCS2D01G184900	chr2D	81.726	197	30	4	1110	1300	136181509	136181313	2.880000e-35	159.0
7	TraesCS2D01G184900	chr2D	80.714	140	21	4	1101	1234	129799225	129799364	1.370000e-18	104.0
8	TraesCS2D01G184900	chr2D	81.102	127	18	4	1114	1234	129789317	129789443	2.290000e-16	97.1
9	TraesCS2D01G184900	chr2D	89.706	68	7	0	1114	1181	129353140	129353207	1.380000e-13	87.9
10	TraesCS2D01G184900	chr2B	93.548	930	51	3	961	1887	183313926	183314849	0.000000e+00	1376.0
11	TraesCS2D01G184900	chr2B	90.057	523	25	5	2293	2791	183315052	183315571	0.000000e+00	652.0
12	TraesCS2D01G184900	chr2B	86.574	216	22	4	214	429	183309124	183309332	6.010000e-57	231.0
13	TraesCS2D01G184900	chr2B	93.043	115	7	1	558	671	183311691	183311805	1.720000e-37	167.0
14	TraesCS2D01G184900	chr2B	91.176	68	6	0	1114	1181	182936470	182936537	2.960000e-15	93.5
15	TraesCS2D01G184900	chr2A	90.233	901	48	4	990	1887	136163261	136164124	0.000000e+00	1140.0
16	TraesCS2D01G184900	chr2A	88.300	641	61	6	1017	1650	136161037	136161670	0.000000e+00	756.0
17	TraesCS2D01G184900	chr2A	82.995	788	86	20	1	771	136159891	136160647	0.000000e+00	669.0
18	TraesCS2D01G184900	chr2A	85.417	528	27	19	2293	2791	136164327	136164833	1.150000e-138	503.0
19	TraesCS2D01G184900	chr2A	84.599	461	41	18	2201	2647	136162122	136162566	5.520000e-117	431.0
20	TraesCS2D01G184900	chr2A	90.311	289	22	2	558	840	136162791	136163079	9.440000e-100	374.0
21	TraesCS2D01G184900	chr2A	86.344	227	23	2	253	472	136162571	136162796	9.990000e-60	241.0
22	TraesCS2D01G184900	chr6D	82.192	292	47	5	30	319	372808349	372808637	2.150000e-61	246.0
23	TraesCS2D01G184900	chr6D	88.770	187	19	2	2028	2214	15801273	15801089	7.780000e-56	228.0
24	TraesCS2D01G184900	chr6D	90.286	175	15	2	2021	2195	229431059	229430887	7.780000e-56	228.0
25	TraesCS2D01G184900	chr4B	93.631	157	10	0	2036	2192	483266534	483266378	4.650000e-58	235.0
26	TraesCS2D01G184900	chr7B	90.698	172	16	0	2022	2193	561750782	561750611	2.160000e-56	230.0
27	TraesCS2D01G184900	chr7D	85.455	220	29	3	30	248	585422174	585421957	2.800000e-55	226.0
28	TraesCS2D01G184900	chrUn	90.643	171	12	4	2036	2206	31220651	31220485	1.010000e-54	224.0
29	TraesCS2D01G184900	chr4D	88.298	188	16	5	2026	2208	81667559	81667745	1.300000e-53	220.0
30	TraesCS2D01G184900	chr3D	78.125	96	15	5	338	431	123616157	123616248	3.880000e-04	56.5

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G184900	chr2D	129958142	129960932	2790	False	5155.000000	5155	100.000000	1	2791	1	chr2D.!!$F5	2790
1	TraesCS2D01G184900	chr2B	183309124	183315571	6447	False	606.500000	1376	90.805500	214	2791	4	chr2B.!!$F2	2577
2	TraesCS2D01G184900	chr2A	136159891	136164833	4942	False	587.714286	1140	86.885571	1	2791	7	chr2A.!!$F1	2790

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
998	6285	0.033228	CGAGCAGGGGAATCTAGCAG	59.967	60.0	0.0	0.0	0.0	4.24	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1924	7214	0.032952	GACAGACCTACACCGTGCAA	59.967	55.0	0.0	0.0	0.0	4.08	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
26	27	2.235016	GTAATGTTGCCCTGGTGACAA	58.765	47.619	0.00	0.00	42.06	3.18
30	31	0.603065	GTTGCCCTGGTGACAAATCC	59.397	55.000	0.00	0.00	42.06	3.01
60	61	1.667830	CTGCCCAAAGCTTCGTCGA	60.668	57.895	0.00	0.00	44.23	4.20
79	80	2.683933	AAGGGGATCGAGTGCCGT	60.684	61.111	0.00	0.00	39.69	5.68
98	99	3.061322	CGTCACACTTATTCCAAACGGA	58.939	45.455	0.00	0.00	0.00	4.69
120	121	0.036164	CCGTCATCCCCAACTCAACA	59.964	55.000	0.00	0.00	0.00	3.33
144	145	0.389948	CGCCAAGACCACTGACCTAC	60.390	60.000	0.00	0.00	0.00	3.18
155	156	4.197750	CCACTGACCTACTATCTACACGT	58.802	47.826	0.00	0.00	0.00	4.49
157	158	4.874396	CACTGACCTACTATCTACACGTCA	59.126	45.833	0.00	0.00	0.00	4.35
158	159	5.353400	CACTGACCTACTATCTACACGTCAA	59.647	44.000	0.00	0.00	0.00	3.18
159	160	6.038382	CACTGACCTACTATCTACACGTCAAT	59.962	42.308	0.00	0.00	0.00	2.57
160	161	6.038382	ACTGACCTACTATCTACACGTCAATG	59.962	42.308	0.00	0.00	0.00	2.82
167	168	0.249120	CTACACGTCAATGCCCCAGA	59.751	55.000	0.00	0.00	0.00	3.86
169	170	0.908910	ACACGTCAATGCCCCAGATA	59.091	50.000	0.00	0.00	0.00	1.98
170	171	1.490490	ACACGTCAATGCCCCAGATAT	59.510	47.619	0.00	0.00	0.00	1.63
174	175	2.303022	CGTCAATGCCCCAGATATAGGT	59.697	50.000	0.00	0.00	0.00	3.08
176	177	4.729868	GTCAATGCCCCAGATATAGGTTT	58.270	43.478	0.00	0.00	0.00	3.27
181	182	2.716969	GCCCCAGATATAGGTTTCCCTT	59.283	50.000	0.00	0.00	42.66	3.95
196	197	2.507992	CTTGCTCTCCTGCCGTCG	60.508	66.667	0.00	0.00	0.00	5.12
200	201	4.200283	CTCTCCTGCCGTCGGAGC	62.200	72.222	17.49	0.06	46.11	4.70
251	252	2.186903	CCAACGGCGGACTAGCAT	59.813	61.111	13.24	0.00	39.27	3.79
265	266	4.202472	GGACTAGCATAATTGGGTAGCCTT	60.202	45.833	13.11	1.35	39.36	4.35
271	272	5.360999	AGCATAATTGGGTAGCCTTCTTTTC	59.639	40.000	13.11	0.00	0.00	2.29
309	310	0.038892	GAGGAACCGCTTCGTGTGTA	60.039	55.000	0.00	0.00	0.00	2.90
410	412	6.863126	GGTTTCAGATATGAAAGTTGTGGTTG	59.137	38.462	15.54	0.00	38.32	3.77

Showing 1 to 25 of 287 entries

Previous1 2 3 4 5…12Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
5	6	1.143889	TGTCACCAGGGCAACATTACA	59.856	47.619	0.00	0.00	39.74	2.41
18	19	0.605319	GGCGAGTGGATTTGTCACCA	60.605	55.000	0.00	0.00	35.87	4.17
26	27	0.674895	GCAGAGTTGGCGAGTGGATT	60.675	55.000	0.00	0.00	0.00	3.01
60	61	2.427245	CGGCACTCGATCCCCTTCT	61.427	63.158	0.00	0.00	42.43	2.85
73	74	1.803334	TGGAATAAGTGTGACGGCAC	58.197	50.000	16.50	16.50	45.35	5.01
74	75	2.550606	GTTTGGAATAAGTGTGACGGCA	59.449	45.455	0.00	0.00	0.00	5.69
98	99	1.125093	TGAGTTGGGGATGACGGTGT	61.125	55.000	0.00	0.00	0.00	4.16
138	139	5.213675	GCATTGACGTGTAGATAGTAGGTC	58.786	45.833	0.00	0.00	0.00	3.85
144	145	2.102420	TGGGGCATTGACGTGTAGATAG	59.898	50.000	0.00	0.00	0.00	2.08
155	156	4.202567	GGAAACCTATATCTGGGGCATTGA	60.203	45.833	0.00	0.00	0.00	2.57
157	158	4.388577	GGAAACCTATATCTGGGGCATT	57.611	45.455	0.00	0.00	0.00	3.56
174	175	1.380302	GGCAGGAGAGCAAGGGAAA	59.620	57.895	0.00	0.00	35.83	3.13
176	177	3.393970	CGGCAGGAGAGCAAGGGA	61.394	66.667	0.00	0.00	35.83	4.20
237	238	1.540363	CCAATTATGCTAGTCCGCCGT	60.540	52.381	0.00	0.00	0.00	5.68
247	248	4.526438	AAGAAGGCTACCCAATTATGCT	57.474	40.909	0.00	0.00	0.00	3.79
251	252	3.692593	GCGAAAAGAAGGCTACCCAATTA	59.307	43.478	0.00	0.00	0.00	1.40
265	266	0.309612	GTTGCGAAAGGGCGAAAAGA	59.690	50.000	0.00	0.00	35.06	2.52
271	272	1.082104	GTTCTGTTGCGAAAGGGCG	60.082	57.895	0.00	0.00	35.06	6.13
309	310	3.470645	AGTAACTGAAACGAGCAACCT	57.529	42.857	0.00	0.00	0.00	3.50
354	355	2.803386	TGCAAACACATACACGTCGATT	59.197	40.909	0.00	0.00	0.00	3.34
426	428	4.452733	CCCGCCAACTCGTCCCTC	62.453	72.222	0.00	0.00	0.00	4.30
429	431	2.741211	GTTCCCGCCAACTCGTCC	60.741	66.667	0.00	0.00	0.00	4.79
432	434	2.752322	TACACGTTCCCGCCAACTCG	62.752	60.000	0.00	0.00	37.70	4.18
434	436	1.005394	CTACACGTTCCCGCCAACT	60.005	57.895	0.00	0.00	37.70	3.16
442	451	1.376812	CTTGCCCCCTACACGTTCC	60.377	63.158	0.00	0.00	0.00	3.62

Showing 1 to 25 of 269 entries

Previous1 2 3 4 5…11Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.