Multiple sequence alignment - TraesCS2D01G175000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G175000 chr2D 100.000 2324 0 0 1 2324 118532905 118535228 0.000000e+00 4292.0
1 TraesCS2D01G175000 chr2D 81.991 211 30 6 1921 2131 11560048 11559846 3.070000e-39 172.0
2 TraesCS2D01G175000 chr2D 79.661 118 17 7 1 114 11559696 11559810 6.880000e-11 78.7
3 TraesCS2D01G175000 chr1D 95.137 2344 74 18 1 2324 239622682 239620359 0.000000e+00 3661.0
4 TraesCS2D01G175000 chr1D 93.248 1481 48 21 863 2324 212525845 212527292 0.000000e+00 2134.0
5 TraesCS2D01G175000 chr4B 94.360 2358 95 14 1 2324 339264490 339262137 0.000000e+00 3583.0
6 TraesCS2D01G175000 chr4B 84.088 685 47 23 1486 2109 480059472 480060155 2.550000e-169 604.0
7 TraesCS2D01G175000 chr4D 93.771 2360 80 17 1 2324 93450268 93447940 0.000000e+00 3482.0
8 TraesCS2D01G175000 chr4D 84.490 677 53 16 1485 2109 390273566 390274242 2.540000e-174 621.0
9 TraesCS2D01G175000 chr3A 94.858 2120 71 15 216 2324 431134968 431137060 0.000000e+00 3277.0
10 TraesCS2D01G175000 chr3A 89.809 157 14 2 1 156 431134802 431134957 1.410000e-47 200.0
11 TraesCS2D01G175000 chr3B 96.306 1191 42 2 1 1189 809806080 809807270 0.000000e+00 1954.0
12 TraesCS2D01G175000 chr3B 94.801 327 15 2 1997 2321 809807372 809807698 2.060000e-140 508.0
13 TraesCS2D01G175000 chr7B 93.225 1107 50 12 1235 2319 375392208 375393311 0.000000e+00 1605.0
14 TraesCS2D01G175000 chr5B 87.420 1399 113 20 144 1484 537784769 537783376 0.000000e+00 1550.0
15 TraesCS2D01G175000 chr5A 87.260 1405 113 21 142 1484 558176235 558174835 0.000000e+00 1543.0
16 TraesCS2D01G175000 chr5D 87.347 1391 112 22 153 1484 441405476 441404091 0.000000e+00 1535.0
17 TraesCS2D01G175000 chr4A 84.334 683 48 25 1485 2109 72026458 72027139 4.240000e-172 614.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G175000 chr2D 118532905 118535228 2323 False 4292.0 4292 100.0000 1 2324 1 chr2D.!!$F2 2323
1 TraesCS2D01G175000 chr1D 239620359 239622682 2323 True 3661.0 3661 95.1370 1 2324 1 chr1D.!!$R1 2323
2 TraesCS2D01G175000 chr1D 212525845 212527292 1447 False 2134.0 2134 93.2480 863 2324 1 chr1D.!!$F1 1461
3 TraesCS2D01G175000 chr4B 339262137 339264490 2353 True 3583.0 3583 94.3600 1 2324 1 chr4B.!!$R1 2323
4 TraesCS2D01G175000 chr4B 480059472 480060155 683 False 604.0 604 84.0880 1486 2109 1 chr4B.!!$F1 623
5 TraesCS2D01G175000 chr4D 93447940 93450268 2328 True 3482.0 3482 93.7710 1 2324 1 chr4D.!!$R1 2323
6 TraesCS2D01G175000 chr4D 390273566 390274242 676 False 621.0 621 84.4900 1485 2109 1 chr4D.!!$F1 624
7 TraesCS2D01G175000 chr3A 431134802 431137060 2258 False 1738.5 3277 92.3335 1 2324 2 chr3A.!!$F1 2323
8 TraesCS2D01G175000 chr3B 809806080 809807698 1618 False 1231.0 1954 95.5535 1 2321 2 chr3B.!!$F1 2320
9 TraesCS2D01G175000 chr7B 375392208 375393311 1103 False 1605.0 1605 93.2250 1235 2319 1 chr7B.!!$F1 1084
10 TraesCS2D01G175000 chr5B 537783376 537784769 1393 True 1550.0 1550 87.4200 144 1484 1 chr5B.!!$R1 1340
11 TraesCS2D01G175000 chr5A 558174835 558176235 1400 True 1543.0 1543 87.2600 142 1484 1 chr5A.!!$R1 1342
12 TraesCS2D01G175000 chr5D 441404091 441405476 1385 True 1535.0 1535 87.3470 153 1484 1 chr5D.!!$R1 1331
13 TraesCS2D01G175000 chr4A 72026458 72027139 681 False 614.0 614 84.3340 1485 2109 1 chr4A.!!$F1 624

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
700 732 0.321475 AGAGAAACAGCCAGCTCAGC 60.321 55.0 0.0 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1575 1674 0.246635 ATGCCTCGTTGTTAGACGCT 59.753 50.0 0.0 0.0 42.5 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 1.423541 TGTGCATGTTTAGTCCTGGGT 59.576 47.619 0.00 0.00 0.00 4.51
57 59 2.222727 AGAGCAGCCAAGTGGAGCT 61.223 57.895 15.09 15.09 46.15 4.09
67 69 2.760385 GTGGAGCTAGCCGGACCT 60.760 66.667 12.13 0.00 0.00 3.85
69 71 2.442272 GGAGCTAGCCGGACCTGA 60.442 66.667 12.13 0.00 0.00 3.86
126 128 3.066342 TGACGTTTTGCCAAATAAACCGA 59.934 39.130 0.00 0.00 32.05 4.69
150 152 4.711949 CGCTCCTTGCCTGCACCT 62.712 66.667 0.00 0.00 38.78 4.00
315 323 4.410883 TCAAAGGTAGGTTCTTGTTCTCCA 59.589 41.667 0.00 0.00 0.00 3.86
700 732 0.321475 AGAGAAACAGCCAGCTCAGC 60.321 55.000 0.00 0.00 0.00 4.26
782 814 4.498177 CGGCGAGATATACAATCCGATGAT 60.498 45.833 0.00 0.00 37.79 2.45
861 893 2.429571 GTCTGCGGCGACACGTTA 60.430 61.111 12.98 0.00 35.98 3.18
1256 1291 3.767806 CGAGCAGAGCTGGAGCCA 61.768 66.667 0.00 0.00 39.88 4.75
1322 1369 1.826340 TTGGCCGTGCTGCTTCTCTA 61.826 55.000 0.00 0.00 0.00 2.43
1392 1442 1.401761 TGTTTGTTGCCATGAGCTGT 58.598 45.000 0.00 0.00 44.23 4.40
1563 1662 1.137872 GAGGATCAGCTGTCCGACATT 59.862 52.381 21.89 10.20 40.76 2.71
1575 1674 1.450134 CGACATTAGCAGCCAGGCA 60.450 57.895 15.80 0.00 35.83 4.75
1867 2017 0.030705 TCCCTCCAGCTCTATGGCTT 60.031 55.000 0.00 0.00 41.00 4.35
2109 2298 3.164977 TCCACTCCGGCCACAACA 61.165 61.111 2.24 0.00 33.14 3.33
2159 2349 1.004440 GAGCCTGACCTGACGCTTT 60.004 57.895 0.00 0.00 0.00 3.51
2278 2469 1.150081 GCTGGCTCCATATGGCTGT 59.850 57.895 17.58 0.00 34.44 4.40
2295 2486 2.101582 GCTGTATCTGATTCGTCCAGGT 59.898 50.000 0.00 0.00 32.73 4.00
2296 2487 3.430929 GCTGTATCTGATTCGTCCAGGTT 60.431 47.826 0.00 0.00 32.73 3.50
2299 2491 6.479972 TGTATCTGATTCGTCCAGGTTAAT 57.520 37.500 0.00 0.00 32.73 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 1.612462 CCACTTGGCTGCTCTGATTGA 60.612 52.381 0.00 0.00 0.00 2.57
77 79 1.996786 ATCTGCAAAATGGCGAGCGG 61.997 55.000 0.00 0.00 36.28 5.52
82 84 0.385390 GGGGTATCTGCAAAATGGCG 59.615 55.000 0.00 0.00 36.28 5.69
461 493 1.741770 GCGGACATCTCAAACGCCT 60.742 57.895 0.00 0.00 44.01 5.52
464 496 0.670546 ACTGGCGGACATCTCAAACG 60.671 55.000 0.00 0.00 0.00 3.60
700 732 0.659957 GCGATAAGAGCTTGCCTTGG 59.340 55.000 0.00 0.00 0.00 3.61
861 893 3.170791 TCGGACTCGAAGTAGACGTAT 57.829 47.619 0.00 0.00 43.03 3.06
1256 1291 4.143333 CGTTCTCCCGGGCGATGT 62.143 66.667 18.49 0.00 0.00 3.06
1292 1339 2.040544 ACGGCCAAGGATTTCAGCG 61.041 57.895 2.24 0.00 0.00 5.18
1322 1369 2.427453 AGAGTACACATCGGCGATCTTT 59.573 45.455 21.25 9.08 0.00 2.52
1392 1442 1.089112 CCGAGCTGCACATCAATCAA 58.911 50.000 1.02 0.00 0.00 2.57
1575 1674 0.246635 ATGCCTCGTTGTTAGACGCT 59.753 50.000 0.00 0.00 42.50 5.07
2076 2265 1.305718 GGAGGAGAGGGAGCACACT 60.306 63.158 0.00 0.00 0.00 3.55
2078 2267 1.610673 GTGGAGGAGAGGGAGCACA 60.611 63.158 0.00 0.00 0.00 4.57
2137 2327 1.979155 CGTCAGGTCAGGCTCCTCA 60.979 63.158 0.00 0.00 32.37 3.86
2159 2349 4.037222 TGGCTGTCAAAGGATATCACCTA 58.963 43.478 4.83 0.00 39.62 3.08
2270 2461 3.895041 TGGACGAATCAGATACAGCCATA 59.105 43.478 0.00 0.00 0.00 2.74
2278 2469 7.201696 GCAAAATTAACCTGGACGAATCAGATA 60.202 37.037 0.00 0.00 34.36 1.98
2295 2486 9.308318 GAACTTGTTCTAAAGGTGCAAAATTAA 57.692 29.630 6.28 0.00 0.00 1.40
2296 2487 7.646130 CGAACTTGTTCTAAAGGTGCAAAATTA 59.354 33.333 11.11 0.00 0.00 1.40
2299 2491 5.124138 TCGAACTTGTTCTAAAGGTGCAAAA 59.876 36.000 11.11 0.00 0.00 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.