AutoCloner

Multiple sequence alignment - TraesCS2D01G165300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G165300	chr2D	100.000	5342	0	0	1	5342	109703854	109709195	0.000000e+00	9865.0
1	TraesCS2D01G165300	chr2D	81.150	1252	177	30	2327	3542	308023924	308022696	0.000000e+00	950.0
2	TraesCS2D01G165300	chr2D	88.889	252	15	2	3311	3550	109706421	109706171	1.120000e-76	298.0
3	TraesCS2D01G165300	chr2D	96.000	100	3	1	5145	5243	532437582	532437483	1.540000e-35	161.0
4	TraesCS2D01G165300	chr2D	96.000	100	3	1	5145	5243	640611094	640610995	1.540000e-35	161.0
5	TraesCS2D01G165300	chr1D	91.552	1231	84	9	2327	3541	193651917	193650691	0.000000e+00	1679.0
6	TraesCS2D01G165300	chr1D	85.622	1245	135	30	2327	3541	460733603	460732373	0.000000e+00	1267.0
7	TraesCS2D01G165300	chr1D	85.352	1222	148	14	2327	3521	250235146	250236363	0.000000e+00	1236.0
8	TraesCS2D01G165300	chr1D	86.806	144	17	2	182	324	200211708	200211566	5.540000e-35	159.0
9	TraesCS2D01G165300	chr1D	94.949	99	2	3	5246	5342	447369366	447369269	9.270000e-33	152.0
10	TraesCS2D01G165300	chr6D	91.477	1232	76	11	2327	3541	255525805	255524586	0.000000e+00	1666.0
11	TraesCS2D01G165300	chr6D	85.783	1245	134	28	2327	3541	8646309	8647540	0.000000e+00	1279.0
12	TraesCS2D01G165300	chr5A	90.341	1232	100	7	2327	3542	475458411	475457183	0.000000e+00	1598.0
13	TraesCS2D01G165300	chr2A	87.719	1254	109	34	3542	4757	105495281	105496527	0.000000e+00	1421.0
14	TraesCS2D01G165300	chr2A	88.562	953	56	15	928	1866	105493760	105494673	0.000000e+00	1107.0
15	TraesCS2D01G165300	chr2A	86.755	453	55	4	1861	2309	105494789	105495240	2.870000e-137	499.0
16	TraesCS2D01G165300	chr2A	89.147	387	9	11	519	896	105493408	105493770	8.160000e-123	451.0
17	TraesCS2D01G165300	chr2A	92.958	142	4	4	4762	4897	105496616	105496757	9.070000e-48	202.0
18	TraesCS2D01G165300	chr2A	90.909	121	7	2	4919	5036	105496817	105496936	5.540000e-35	159.0
19	TraesCS2D01G165300	chr2A	95.349	43	2	0	468	510	105493331	105493373	9.600000e-08	69.4
20	TraesCS2D01G165300	chr2B	85.808	1374	110	35	969	2308	159209477	159210799	0.000000e+00	1378.0
21	TraesCS2D01G165300	chr2B	85.521	739	55	21	4047	4743	159212433	159213161	0.000000e+00	725.0
22	TraesCS2D01G165300	chr2B	90.960	531	37	4	3537	4057	159210839	159211368	0.000000e+00	704.0
23	TraesCS2D01G165300	chr2B	84.932	146	22	0	182	327	145366178	145366033	1.200000e-31	148.0
24	TraesCS2D01G165300	chr2B	92.537	67	5	0	5164	5230	787026385	787026319	4.400000e-16	97.1
25	TraesCS2D01G165300	chr2B	90.625	64	2	3	778	837	159209407	159209470	1.230000e-11	82.4
26	TraesCS2D01G165300	chr5D	90.302	959	57	12	2327	3282	362041406	362040481	0.000000e+00	1223.0
27	TraesCS2D01G165300	chr5D	89.000	300	18	3	3262	3546	362040531	362040232	1.830000e-94	357.0
28	TraesCS2D01G165300	chr5D	90.043	231	23	0	3311	3541	362041176	362041406	3.130000e-77	300.0
29	TraesCS2D01G165300	chr5D	96.842	95	2	1	5249	5342	424588572	424588666	1.990000e-34	158.0
30	TraesCS2D01G165300	chr5D	100.000	85	0	0	5258	5342	438392207	438392291	1.990000e-34	158.0
31	TraesCS2D01G165300	chr5D	85.315	143	18	3	184	324	269336081	269335940	1.550000e-30	145.0
32	TraesCS2D01G165300	chr1B	88.778	802	78	1	2381	3182	476909133	476908344	0.000000e+00	972.0
33	TraesCS2D01G165300	chr1B	98.851	87	1	0	5256	5342	21375023	21374937	7.160000e-34	156.0
34	TraesCS2D01G165300	chr1B	85.915	142	20	0	182	323	443589368	443589227	9.270000e-33	152.0
35	TraesCS2D01G165300	chr4B	84.623	969	119	23	2327	3281	66107706	66106754	0.000000e+00	937.0
36	TraesCS2D01G165300	chr4B	97.826	92	2	0	5251	5342	519037584	519037675	5.540000e-35	159.0
37	TraesCS2D01G165300	chr7A	85.870	736	69	16	2756	3487	641952342	641953046	0.000000e+00	750.0
38	TraesCS2D01G165300	chr3D	93.469	245	14	2	2327	2570	520706421	520706664	3.930000e-96	363.0
39	TraesCS2D01G165300	chr3D	97.959	98	1	1	5146	5243	609559637	609559733	9.200000e-38	169.0
40	TraesCS2D01G165300	chr3D	88.806	134	15	0	189	322	124059590	124059457	1.190000e-36	165.0
41	TraesCS2D01G165300	chr3D	96.939	98	3	0	5145	5242	500204147	500204050	1.190000e-36	165.0
42	TraesCS2D01G165300	chr3D	98.864	88	1	0	5255	5342	209076423	209076336	1.990000e-34	158.0
43	TraesCS2D01G165300	chr3D	86.207	145	20	0	182	326	482504822	482504966	1.990000e-34	158.0
44	TraesCS2D01G165300	chr3D	94.949	99	2	3	5246	5342	12307856	12307953	9.270000e-33	152.0
45	TraesCS2D01G165300	chr6A	86.972	284	29	5	3262	3541	535009798	535009519	4.020000e-81	313.0
46	TraesCS2D01G165300	chr6A	90.909	231	21	0	3311	3541	535010471	535010701	1.440000e-80	311.0
47	TraesCS2D01G165300	chr7B	91.803	122	10	0	205	326	431680438	431680317	2.560000e-38	171.0
48	TraesCS2D01G165300	chr7D	91.736	121	10	0	206	326	593264986	593265106	9.200000e-38	169.0
49	TraesCS2D01G165300	chr7D	100.000	86	0	0	5257	5342	123382295	123382210	5.540000e-35	159.0
50	TraesCS2D01G165300	chr6B	79.848	263	25	13	3543	3797	684274660	684274902	3.310000e-37	167.0
51	TraesCS2D01G165300	chr4D	95.098	102	3	2	5141	5242	54053244	54053343	5.540000e-35	159.0
52	TraesCS2D01G165300	chr4D	96.774	93	3	0	5250	5342	385641566	385641658	7.160000e-34	156.0
53	TraesCS2D01G165300	chr3B	85.315	143	20	1	182	324	614203018	614203159	4.310000e-31	147.0
54	TraesCS2D01G165300	chr1A	87.273	110	7	5	5143	5245	579778160	579778051	9.400000e-23	119.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G165300	chr2D	109703854	109709195	5341	False	9865.000000	9865	100.000000	1	5342	1	chr2D.!!$F1	5341
1	TraesCS2D01G165300	chr2D	308022696	308023924	1228	True	950.000000	950	81.150000	2327	3542	1	chr2D.!!$R2	1215
2	TraesCS2D01G165300	chr1D	193650691	193651917	1226	True	1679.000000	1679	91.552000	2327	3541	1	chr1D.!!$R1	1214
3	TraesCS2D01G165300	chr1D	460732373	460733603	1230	True	1267.000000	1267	85.622000	2327	3541	1	chr1D.!!$R4	1214
4	TraesCS2D01G165300	chr1D	250235146	250236363	1217	False	1236.000000	1236	85.352000	2327	3521	1	chr1D.!!$F1	1194
5	TraesCS2D01G165300	chr6D	255524586	255525805	1219	True	1666.000000	1666	91.477000	2327	3541	1	chr6D.!!$R1	1214
6	TraesCS2D01G165300	chr6D	8646309	8647540	1231	False	1279.000000	1279	85.783000	2327	3541	1	chr6D.!!$F1	1214
7	TraesCS2D01G165300	chr5A	475457183	475458411	1228	True	1598.000000	1598	90.341000	2327	3542	1	chr5A.!!$R1	1215
8	TraesCS2D01G165300	chr2A	105493331	105496936	3605	False	558.342857	1421	90.199857	468	5036	7	chr2A.!!$F1	4568
9	TraesCS2D01G165300	chr2B	159209407	159213161	3754	False	722.350000	1378	88.228500	778	4743	4	chr2B.!!$F1	3965
10	TraesCS2D01G165300	chr5D	362040232	362041406	1174	True	790.000000	1223	89.651000	2327	3546	2	chr5D.!!$R2	1219
11	TraesCS2D01G165300	chr1B	476908344	476909133	789	True	972.000000	972	88.778000	2381	3182	1	chr1B.!!$R3	801
12	TraesCS2D01G165300	chr4B	66106754	66107706	952	True	937.000000	937	84.623000	2327	3281	1	chr4B.!!$R1	954
13	TraesCS2D01G165300	chr7A	641952342	641953046	704	False	750.000000	750	85.870000	2756	3487	1	chr7A.!!$F1	731

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
316	317	0.037419	AATTTTTGCTTCCGGCGCAT	60.037	45.0	17.16	1.99	45.43	4.73	F
453	454	0.040351	CCTCCCCTGTCAGACTCTCA	59.960	60.0	0.00	0.00	0.00	3.27	F
720	747	0.102481	CACAATCCGTACCCTCCTCG	59.898	60.0	0.00	0.00	0.00	4.63	F
1343	1401	0.107654	AACCCAGCCGAGCTAATCAC	60.108	55.0	0.00	0.00	36.40	3.06	F
1885	2078	0.744874	CGGTCGATTGGCTTCCTCTA	59.255	55.0	0.00	0.00	0.00	2.43	F
3241	3497	0.768221	GCCATGGGAGGGACCTGATA	60.768	60.0	15.13	0.00	38.98	2.15	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1314	1372	0.804989	CGGCTGGGTTTCTGTTCATC	59.195	55.000	0.00	0.00	0.00	2.92	R
2250	2456	0.839277	AGCGATGGTCCATTCATCCA	59.161	50.000	5.65	0.00	38.13	3.41	R
2632	2859	0.033504	GCTGTCTCCGGTGAACTTCA	59.966	55.000	7.99	1.11	0.00	3.02	R
2791	3018	1.073199	CGGCAAGGTGGAAGAAGGT	59.927	57.895	0.00	0.00	0.00	3.50	R
3730	4007	0.879090	CACTAAGGGGAAAACGGCAC	59.121	55.000	0.00	0.00	0.00	5.01	R
4711	6116	0.179092	GCCATGCCCAAAGATTCAGC	60.179	55.000	0.00	0.00	0.00	4.26	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
18	19	3.363787	GAAGACAAACCCATGGGCT	57.636	52.632	31.73	17.32	39.32	5.19
19	20	1.177401	GAAGACAAACCCATGGGCTC	58.823	55.000	31.73	18.91	39.32	4.70
20	21	0.609131	AAGACAAACCCATGGGCTCG	60.609	55.000	31.73	20.47	39.32	5.03
21	22	2.676471	ACAAACCCATGGGCTCGC	60.676	61.111	31.73	0.00	39.32	5.03
22	23	3.451894	CAAACCCATGGGCTCGCC	61.452	66.667	31.73	0.00	39.32	5.54
35	36	4.251843	TCGCCGGCGAAGATCGAG	62.252	66.667	46.56	17.71	46.01	4.04
37	38	4.951963	GCCGGCGAAGATCGAGGG	62.952	72.222	12.58	4.73	43.74	4.30
38	39	4.286320	CCGGCGAAGATCGAGGGG	62.286	72.222	9.30	0.00	43.74	4.79
39	40	3.217017	CGGCGAAGATCGAGGGGA	61.217	66.667	0.00	0.00	43.74	4.81
40	41	2.417936	GGCGAAGATCGAGGGGAC	59.582	66.667	3.61	0.00	43.74	4.46
41	42	2.026301	GCGAAGATCGAGGGGACG	59.974	66.667	3.61	0.00	43.74	4.79
42	43	2.026301	CGAAGATCGAGGGGACGC	59.974	66.667	0.00	0.00	43.74	5.19
43	44	2.771639	CGAAGATCGAGGGGACGCA	61.772	63.158	0.00	0.00	43.74	5.24
44	45	1.066587	GAAGATCGAGGGGACGCAG	59.933	63.158	0.00	0.00	0.00	5.18
45	46	1.379977	AAGATCGAGGGGACGCAGA	60.380	57.895	0.00	0.00	0.00	4.26
46	47	1.668101	AAGATCGAGGGGACGCAGAC	61.668	60.000	0.00	0.00	0.00	3.51
47	48	2.043852	ATCGAGGGGACGCAGACT	60.044	61.111	0.00	0.00	0.00	3.24
48	49	1.668101	GATCGAGGGGACGCAGACTT	61.668	60.000	0.00	0.00	0.00	3.01
49	50	1.258445	ATCGAGGGGACGCAGACTTT	61.258	55.000	0.00	0.00	0.00	2.66
50	51	1.738099	CGAGGGGACGCAGACTTTG	60.738	63.158	0.00	0.00	0.00	2.77
59	60	3.972227	CAGACTTTGCCCTGGTCG	58.028	61.111	0.00	0.00	35.42	4.79
60	61	1.071471	CAGACTTTGCCCTGGTCGT	59.929	57.895	0.00	0.00	35.42	4.34
61	62	0.951040	CAGACTTTGCCCTGGTCGTC	60.951	60.000	0.00	0.00	35.42	4.20
62	63	1.122019	AGACTTTGCCCTGGTCGTCT	61.122	55.000	0.00	0.00	35.42	4.18
63	64	0.250338	GACTTTGCCCTGGTCGTCTT	60.250	55.000	0.00	0.00	0.00	3.01

Showing 1 to 25 of 700 entries

Previous1 2 3 4 5…28Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
1	2	0.609131	CGAGCCCATGGGTTTGTCTT	60.609	55.000	31.58	9.04	37.65	3.01
2	3	1.002134	CGAGCCCATGGGTTTGTCT	60.002	57.895	31.58	19.52	37.65	3.41
3	4	2.700773	GCGAGCCCATGGGTTTGTC	61.701	63.158	31.58	20.18	37.65	3.18
4	5	2.676471	GCGAGCCCATGGGTTTGT	60.676	61.111	31.58	14.31	37.65	2.83
5	6	3.451894	GGCGAGCCCATGGGTTTG	61.452	66.667	31.58	29.03	37.65	2.93
20	21	4.951963	CCCTCGATCTTCGCCGGC	62.952	72.222	19.07	19.07	40.21	6.13
21	22	4.286320	CCCCTCGATCTTCGCCGG	62.286	72.222	0.00	0.00	40.21	6.13
22	23	3.217017	TCCCCTCGATCTTCGCCG	61.217	66.667	0.00	0.00	40.21	6.46
23	24	2.417936	GTCCCCTCGATCTTCGCC	59.582	66.667	0.00	0.00	40.21	5.54
24	25	2.026301	CGTCCCCTCGATCTTCGC	59.974	66.667	0.00	0.00	40.21	4.70
25	26	2.026301	GCGTCCCCTCGATCTTCG	59.974	66.667	0.00	0.00	42.10	3.79
26	27	1.066587	CTGCGTCCCCTCGATCTTC	59.933	63.158	0.00	0.00	0.00	2.87
27	28	1.379977	TCTGCGTCCCCTCGATCTT	60.380	57.895	0.00	0.00	0.00	2.40
28	29	2.122167	GTCTGCGTCCCCTCGATCT	61.122	63.158	0.00	0.00	0.00	2.75
29	30	1.668101	AAGTCTGCGTCCCCTCGATC	61.668	60.000	0.00	0.00	0.00	3.69
30	31	1.258445	AAAGTCTGCGTCCCCTCGAT	61.258	55.000	0.00	0.00	0.00	3.59
31	32	1.906824	AAAGTCTGCGTCCCCTCGA	60.907	57.895	0.00	0.00	0.00	4.04
32	33	1.738099	CAAAGTCTGCGTCCCCTCG	60.738	63.158	0.00	0.00	0.00	4.63
33	34	2.035442	GCAAAGTCTGCGTCCCCTC	61.035	63.158	0.00	0.00	42.37	4.30
34	35	2.032681	GCAAAGTCTGCGTCCCCT	59.967	61.111	0.00	0.00	42.37	4.79
42	43	0.951040	GACGACCAGGGCAAAGTCTG	60.951	60.000	0.00	0.00	0.00	3.51
43	44	1.122019	AGACGACCAGGGCAAAGTCT	61.122	55.000	0.00	0.00	34.54	3.24
44	45	0.250338	AAGACGACCAGGGCAAAGTC	60.250	55.000	0.00	0.00	0.00	3.01
45	46	0.182775	AAAGACGACCAGGGCAAAGT	59.817	50.000	0.00	0.00	0.00	2.66
46	47	0.593128	CAAAGACGACCAGGGCAAAG	59.407	55.000	0.00	0.00	0.00	2.77

Showing 1 to 25 of 705 entries

Previous1 2 3 4 5…29Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.