Multiple sequence alignment - TraesCS2D01G161000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G161000 chr2D 100.000 2264 0 0 1 2264 104929539 104927276 0.000000e+00 4181.0
1 TraesCS2D01G161000 chr2D 98.519 2161 31 1 1 2161 89187448 89189607 0.000000e+00 3812.0
2 TraesCS2D01G161000 chr2D 88.565 1373 108 31 705 2062 126689045 126687707 0.000000e+00 1620.0
3 TraesCS2D01G161000 chr2D 94.348 230 12 1 2035 2264 126687594 126687366 3.580000e-93 351.0
4 TraesCS2D01G161000 chr2D 96.552 87 3 0 2178 2264 89189861 89189947 6.520000e-31 145.0
5 TraesCS2D01G161000 chr7B 93.783 1866 96 8 1 1865 535437137 535435291 0.000000e+00 2785.0
6 TraesCS2D01G161000 chr7B 93.071 1804 98 13 1 1797 666615855 666617638 0.000000e+00 2614.0
7 TraesCS2D01G161000 chr7B 92.511 1589 97 10 1 1584 664951456 664949885 0.000000e+00 2255.0
8 TraesCS2D01G161000 chr7B 90.870 230 18 1 2035 2264 692399028 692399254 2.830000e-79 305.0
9 TraesCS2D01G161000 chr5B 93.516 1866 102 10 1 1865 123786987 123788834 0.000000e+00 2758.0
10 TraesCS2D01G161000 chr5B 92.865 1850 104 12 1 1849 514050684 514052506 0.000000e+00 2660.0
11 TraesCS2D01G161000 chr5B 92.873 1768 103 11 1 1762 353930722 353928972 0.000000e+00 2545.0
12 TraesCS2D01G161000 chr5B 87.446 231 23 4 2035 2264 123789156 123789381 6.200000e-66 261.0
13 TraesCS2D01G161000 chr5B 97.368 38 1 0 2035 2072 677837039 677837076 5.220000e-07 65.8
14 TraesCS2D01G161000 chr3D 90.558 2097 151 28 1 2088 581472642 581474700 0.000000e+00 2732.0
15 TraesCS2D01G161000 chr3D 91.880 234 13 3 2035 2264 581474717 581474948 2.810000e-84 322.0
16 TraesCS2D01G161000 chr6B 90.057 2092 145 28 1 2083 77328156 77326119 0.000000e+00 2652.0
17 TraesCS2D01G161000 chr6B 93.204 103 7 0 2035 2137 715469749 715469647 3.890000e-33 152.0
18 TraesCS2D01G161000 chr3B 92.930 1768 100 10 1 1762 734227352 734225604 0.000000e+00 2549.0
19 TraesCS2D01G161000 chr3B 90.287 1884 140 24 1 1880 21645000 21646844 0.000000e+00 2425.0
20 TraesCS2D01G161000 chr4B 92.944 1148 61 10 667 1813 522404484 522405612 0.000000e+00 1653.0
21 TraesCS2D01G161000 chr4B 89.565 230 20 1 2035 2264 633306661 633306886 2.850000e-74 289.0
22 TraesCS2D01G161000 chr4B 94.624 93 5 0 2172 2264 624364288 624364380 6.520000e-31 145.0
23 TraesCS2D01G161000 chr4A 93.309 1106 57 11 676 1780 692376407 692375318 0.000000e+00 1616.0
24 TraesCS2D01G161000 chr4A 85.169 236 25 6 1721 1949 692375412 692375180 1.350000e-57 233.0
25 TraesCS2D01G161000 chr5D 97.368 38 1 0 2035 2072 537241182 537241219 5.220000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G161000 chr2D 104927276 104929539 2263 True 4181.0 4181 100.0000 1 2264 1 chr2D.!!$R1 2263
1 TraesCS2D01G161000 chr2D 89187448 89189947 2499 False 1978.5 3812 97.5355 1 2264 2 chr2D.!!$F1 2263
2 TraesCS2D01G161000 chr2D 126687366 126689045 1679 True 985.5 1620 91.4565 705 2264 2 chr2D.!!$R2 1559
3 TraesCS2D01G161000 chr7B 535435291 535437137 1846 True 2785.0 2785 93.7830 1 1865 1 chr7B.!!$R1 1864
4 TraesCS2D01G161000 chr7B 666615855 666617638 1783 False 2614.0 2614 93.0710 1 1797 1 chr7B.!!$F1 1796
5 TraesCS2D01G161000 chr7B 664949885 664951456 1571 True 2255.0 2255 92.5110 1 1584 1 chr7B.!!$R2 1583
6 TraesCS2D01G161000 chr5B 514050684 514052506 1822 False 2660.0 2660 92.8650 1 1849 1 chr5B.!!$F1 1848
7 TraesCS2D01G161000 chr5B 353928972 353930722 1750 True 2545.0 2545 92.8730 1 1762 1 chr5B.!!$R1 1761
8 TraesCS2D01G161000 chr5B 123786987 123789381 2394 False 1509.5 2758 90.4810 1 2264 2 chr5B.!!$F3 2263
9 TraesCS2D01G161000 chr3D 581472642 581474948 2306 False 1527.0 2732 91.2190 1 2264 2 chr3D.!!$F1 2263
10 TraesCS2D01G161000 chr6B 77326119 77328156 2037 True 2652.0 2652 90.0570 1 2083 1 chr6B.!!$R1 2082
11 TraesCS2D01G161000 chr3B 734225604 734227352 1748 True 2549.0 2549 92.9300 1 1762 1 chr3B.!!$R1 1761
12 TraesCS2D01G161000 chr3B 21645000 21646844 1844 False 2425.0 2425 90.2870 1 1880 1 chr3B.!!$F1 1879
13 TraesCS2D01G161000 chr4B 522404484 522405612 1128 False 1653.0 1653 92.9440 667 1813 1 chr4B.!!$F1 1146
14 TraesCS2D01G161000 chr4A 692375180 692376407 1227 True 924.5 1616 89.2390 676 1949 2 chr4A.!!$R1 1273

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
363 364 1.682849 CATCCGTTCCTGGACCCAA 59.317 57.895 0.0 0.0 41.85 4.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1868 2117 0.036671 CGGCGGGAAGTTTACCTCTT 60.037 55.0 0.0 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
237 238 4.584743 AGTATCATTGGTCGTGCTCTCATA 59.415 41.667 0.00 0.00 0.00 2.15
363 364 1.682849 CATCCGTTCCTGGACCCAA 59.317 57.895 0.00 0.00 41.85 4.12
1293 1306 8.884323 AGTAGGCTATTCTCCATTATGATTCAA 58.116 33.333 0.00 0.00 0.00 2.69
1868 2117 7.459795 TGTGCTACAAAATTGTCATATCCAA 57.540 32.000 1.37 0.00 42.35 3.53
1884 2141 3.412237 TCCAAAGAGGTAAACTTCCCG 57.588 47.619 0.00 0.00 39.02 5.14
2011 2459 4.103469 TGAGGTAAAGCTTCTGTAAACCCA 59.897 41.667 0.00 0.08 0.00 4.51
2018 2466 1.804748 CTTCTGTAAACCCAAGACGCC 59.195 52.381 0.00 0.00 0.00 5.68
2151 2603 4.020617 CACCCCCGAGCTTCTGCA 62.021 66.667 0.00 0.00 42.74 4.41
2198 2886 3.399305 ACCAAACTCCCCTCAAATCTCTT 59.601 43.478 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
237 238 0.802494 GACGACGCCACCATCAAAAT 59.198 50.000 0.00 0.0 0.00 1.82
363 364 3.118261 CCATTATAGTCAGGCCACTGTGT 60.118 47.826 5.01 0.0 45.14 3.72
1868 2117 0.036671 CGGCGGGAAGTTTACCTCTT 60.037 55.000 0.00 0.0 0.00 2.85
1884 2141 1.134694 GCGTCTTGGTTTCATCGGC 59.865 57.895 0.00 0.0 0.00 5.54
2011 2459 4.052229 CGTGACTCCCGGCGTCTT 62.052 66.667 18.94 0.0 32.70 3.01
2018 2466 4.778415 CAGACGCCGTGACTCCCG 62.778 72.222 0.00 0.0 0.00 5.14
2160 2612 0.545309 TGGTTGGGGGAGAGAGAGTG 60.545 60.000 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.