Multiple sequence alignment - TraesCS2D01G158100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G158100 chr2D 100.000 2471 0 0 1 2471 101758842 101756372 0 4564
1 TraesCS2D01G158100 chr2D 96.509 2492 64 12 1 2471 33425336 33422847 0 4098
2 TraesCS2D01G158100 chr2D 96.564 2474 71 8 1 2470 522818274 522820737 0 4085
3 TraesCS2D01G158100 chr3D 97.454 2474 54 5 1 2471 516290698 516288231 0 4211
4 TraesCS2D01G158100 chr3D 97.212 2475 57 8 1 2471 16702268 16699802 0 4178
5 TraesCS2D01G158100 chr4D 97.251 2474 61 4 1 2471 489010146 489007677 0 4185
6 TraesCS2D01G158100 chr4D 96.646 2475 72 6 1 2471 466950269 466952736 0 4100
7 TraesCS2D01G158100 chr4D 97.340 2406 59 5 69 2471 482596706 482594303 0 4084
8 TraesCS2D01G158100 chr1D 97.090 2474 65 5 1 2471 100579745 100582214 0 4163
9 TraesCS2D01G158100 chr6D 96.571 2479 75 6 1 2469 437059015 437061493 0 4098


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G158100 chr2D 101756372 101758842 2470 True 4564 4564 100.000 1 2471 1 chr2D.!!$R2 2470
1 TraesCS2D01G158100 chr2D 33422847 33425336 2489 True 4098 4098 96.509 1 2471 1 chr2D.!!$R1 2470
2 TraesCS2D01G158100 chr2D 522818274 522820737 2463 False 4085 4085 96.564 1 2470 1 chr2D.!!$F1 2469
3 TraesCS2D01G158100 chr3D 516288231 516290698 2467 True 4211 4211 97.454 1 2471 1 chr3D.!!$R2 2470
4 TraesCS2D01G158100 chr3D 16699802 16702268 2466 True 4178 4178 97.212 1 2471 1 chr3D.!!$R1 2470
5 TraesCS2D01G158100 chr4D 489007677 489010146 2469 True 4185 4185 97.251 1 2471 1 chr4D.!!$R2 2470
6 TraesCS2D01G158100 chr4D 466950269 466952736 2467 False 4100 4100 96.646 1 2471 1 chr4D.!!$F1 2470
7 TraesCS2D01G158100 chr4D 482594303 482596706 2403 True 4084 4084 97.340 69 2471 1 chr4D.!!$R1 2402
8 TraesCS2D01G158100 chr1D 100579745 100582214 2469 False 4163 4163 97.090 1 2471 1 chr1D.!!$F1 2470
9 TraesCS2D01G158100 chr6D 437059015 437061493 2478 False 4098 4098 96.571 1 2469 1 chr6D.!!$F1 2468

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
362 394 1.20251 GCTCGACCGTCCTCTCTACTA 60.203 57.143 0.0 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1755 1792 1.522806 GTCAGTGCCACGTCACCAA 60.523 57.895 3.92 0.0 37.68 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 231 6.379703 TGAACTTCCTTGAACTGGATTTTGAA 59.620 34.615 0.00 0.00 33.09 2.69
294 326 6.006449 AGCTCTAAACATTCATGTGTCCTTT 58.994 36.000 0.00 0.00 41.61 3.11
330 362 3.691118 ACACCATCGAAGACCATGATTTG 59.309 43.478 0.00 0.00 42.51 2.32
362 394 1.202510 GCTCGACCGTCCTCTCTACTA 60.203 57.143 0.00 0.00 0.00 1.82
482 514 9.516314 CTTTCAAAAATCCGAGTTACTTTCTTT 57.484 29.630 0.00 0.00 0.00 2.52
484 516 9.511144 TTCAAAAATCCGAGTTACTTTCTTTTC 57.489 29.630 0.00 0.00 0.00 2.29
552 584 8.964476 AGACTGATTTCTTCTTGTGTTTTCTA 57.036 30.769 0.00 0.00 0.00 2.10
957 991 5.174395 CAGAGCTTCTGCAGTAGTGTATTT 58.826 41.667 19.97 1.83 37.72 1.40
1088 1124 1.072965 GCTCTGGGGGATGTTAGATGG 59.927 57.143 0.00 0.00 0.00 3.51
1562 1598 5.235850 TGGTTACTTGACTAAAGGCATGA 57.764 39.130 5.77 0.00 40.51 3.07
1660 1697 0.251121 TTTCAAAGAGGGCGCATCCA 60.251 50.000 10.83 0.00 36.21 3.41
1836 1873 3.581024 AGCACTGGCACACATAAAATG 57.419 42.857 0.00 0.00 44.61 2.32
1878 1915 2.281484 TCCTGAAGCCAACGCACC 60.281 61.111 0.00 0.00 37.52 5.01
1975 2012 3.695606 GAGGTCGCTGGGAGCACA 61.696 66.667 23.05 0.00 45.66 4.57
2017 2054 1.234615 GGCCATGTGCACGTACAGTT 61.235 55.000 12.10 0.00 43.89 3.16
2038 2075 1.071471 CCACGAAAGGAGGCAGTGT 59.929 57.895 0.00 0.00 0.00 3.55
2075 2112 0.590682 CGCACTGGTTTACATGCACA 59.409 50.000 0.00 0.00 35.02 4.57
2177 2214 5.858049 CACACGAATGTTTTTGTAGCATCAT 59.142 36.000 0.00 0.00 36.72 2.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 4.561500 TTCGAGAGGAGAGAGAGAGAAA 57.438 45.455 0.00 0.00 0.00 2.52
200 231 6.506538 AGCAGGAAATCACCTACATAGAAT 57.493 37.500 0.00 0.00 38.32 2.40
294 326 2.409064 TGGTGTCAGGGTTCTCCTAA 57.591 50.000 0.00 0.00 46.12 2.69
330 362 1.291132 GGTCGAGCTCTTTGCCATAC 58.709 55.000 12.85 0.00 44.23 2.39
362 394 3.055094 AGGCTTGGTATCGTGAAGAACAT 60.055 43.478 0.00 0.00 0.00 2.71
482 514 8.044309 TCCTATATCCAAACAGTTTGATTCGAA 58.956 33.333 25.08 0.00 43.26 3.71
484 516 7.495934 AGTCCTATATCCAAACAGTTTGATTCG 59.504 37.037 25.08 10.08 43.26 3.34
552 584 6.959639 ACACAATGTTTCCTACAATCAACT 57.040 33.333 0.00 0.00 40.89 3.16
1040 1076 4.712051 AGGCACCTCTGCATAATGATAA 57.288 40.909 0.00 0.00 46.28 1.75
1088 1124 2.228343 GCTTGCCTATCATCATTGCTCC 59.772 50.000 0.00 0.00 0.00 4.70
1636 1673 4.154918 GGATGCGCCCTCTTTGAAATATAG 59.845 45.833 4.18 0.00 0.00 1.31
1660 1697 2.932614 CGATCCAAGACGAAAGATTGCT 59.067 45.455 0.00 0.00 32.61 3.91
1755 1792 1.522806 GTCAGTGCCACGTCACCAA 60.523 57.895 3.92 0.00 37.68 3.67
1836 1873 4.407496 AGCGCGACTCTATAGATTGTAC 57.593 45.455 12.10 0.00 0.00 2.90
1878 1915 1.811266 CAATCGAGTCGGCACTGGG 60.811 63.158 13.54 0.00 30.63 4.45
1975 2012 4.006319 GTGGCTCTGCTTAATCTCAAACT 58.994 43.478 0.00 0.00 0.00 2.66
2038 2075 1.660355 GTCTGCAGTGACCAGACGA 59.340 57.895 14.67 0.00 46.56 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.