Multiple sequence alignment - TraesCS2D01G155800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G155800 chr2D 100.000 2601 0 0 530 3130 99190053 99192653 0.000000e+00 4804
1 TraesCS2D01G155800 chr2D 97.642 2587 41 11 552 3130 396654134 396656708 0.000000e+00 4421
2 TraesCS2D01G155800 chr2D 97.487 2587 44 11 552 3130 10438964 10441537 0.000000e+00 4397
3 TraesCS2D01G155800 chr2D 100.000 129 0 0 1 129 99189524 99189652 4.030000e-59 239
4 TraesCS2D01G155800 chr2D 98.450 129 2 0 1 129 10437937 10438065 8.730000e-56 228
5 TraesCS2D01G155800 chr2D 96.124 129 5 0 1 129 573468061 573468189 8.790000e-51 211
6 TraesCS2D01G155800 chr6D 98.196 2605 35 10 530 3130 62262284 62264880 0.000000e+00 4540
7 TraesCS2D01G155800 chr6D 97.566 2588 47 8 549 3130 26591491 26594068 0.000000e+00 4416
8 TraesCS2D01G155800 chr6D 96.850 127 4 0 1 127 90428763 90428889 2.450000e-51 213
9 TraesCS2D01G155800 chr7D 98.081 2606 36 6 530 3130 598441973 598444569 0.000000e+00 4523
10 TraesCS2D01G155800 chr7D 99.225 129 1 0 1 129 82914455 82914327 1.880000e-57 233
11 TraesCS2D01G155800 chr7D 99.225 129 1 0 1 129 598440871 598440999 1.880000e-57 233
12 TraesCS2D01G155800 chr7D 96.124 129 5 0 1 129 64455948 64456076 8.790000e-51 211
13 TraesCS2D01G155800 chr1D 98.068 2588 38 6 547 3130 342837430 342840009 0.000000e+00 4492
14 TraesCS2D01G155800 chr3D 97.876 2589 36 11 549 3130 86230607 86233183 0.000000e+00 4458
15 TraesCS2D01G155800 chr3D 97.603 2587 41 12 552 3130 236674409 236676982 0.000000e+00 4414
16 TraesCS2D01G155800 chr3D 97.491 2591 43 13 549 3130 99815343 99817920 0.000000e+00 4405
17 TraesCS2D01G155800 chr3D 96.899 129 4 0 1 129 123375282 123375154 1.890000e-52 217
18 TraesCS2D01G155800 chr5D 97.674 129 3 0 1 129 361414652 361414524 4.060000e-54 222
19 TraesCS2D01G155800 chr5D 95.349 129 6 0 1 129 29020481 29020353 4.090000e-49 206


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G155800 chr2D 99189524 99192653 3129 False 2521.5 4804 100.0000 1 3130 2 chr2D.!!$F4 3129
1 TraesCS2D01G155800 chr2D 396654134 396656708 2574 False 4421.0 4421 97.6420 552 3130 1 chr2D.!!$F1 2578
2 TraesCS2D01G155800 chr2D 10437937 10441537 3600 False 2312.5 4397 97.9685 1 3130 2 chr2D.!!$F3 3129
3 TraesCS2D01G155800 chr6D 62262284 62264880 2596 False 4540.0 4540 98.1960 530 3130 1 chr6D.!!$F2 2600
4 TraesCS2D01G155800 chr6D 26591491 26594068 2577 False 4416.0 4416 97.5660 549 3130 1 chr6D.!!$F1 2581
5 TraesCS2D01G155800 chr7D 598440871 598444569 3698 False 2378.0 4523 98.6530 1 3130 2 chr7D.!!$F2 3129
6 TraesCS2D01G155800 chr1D 342837430 342840009 2579 False 4492.0 4492 98.0680 547 3130 1 chr1D.!!$F1 2583
7 TraesCS2D01G155800 chr3D 86230607 86233183 2576 False 4458.0 4458 97.8760 549 3130 1 chr3D.!!$F1 2581
8 TraesCS2D01G155800 chr3D 236674409 236676982 2573 False 4414.0 4414 97.6030 552 3130 1 chr3D.!!$F3 2578
9 TraesCS2D01G155800 chr3D 99815343 99817920 2577 False 4405.0 4405 97.4910 549 3130 1 chr3D.!!$F2 2581

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
550 1124 4.906537 AAAAGGGGGCAACGGCGT 62.907 61.111 6.77 6.77 42.47 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2913 3505 1.731709 CGGAGCACACGAAATCATCAA 59.268 47.619 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
550 1124 4.906537 AAAAGGGGGCAACGGCGT 62.907 61.111 6.77 6.77 42.47 5.68
1197 1782 2.037121 TCTGCACTTTCTCCGTCATCAA 59.963 45.455 0.00 0.00 0.00 2.57
1723 2314 4.043200 GCAGAACAAGCCGGGCAC 62.043 66.667 23.09 6.91 0.00 5.01
1918 2509 0.916358 ATTGCTACTCCCCCTGCTGT 60.916 55.000 0.00 0.00 0.00 4.40
2913 3505 1.893801 ACGTGAAGACTTCCCGAATCT 59.106 47.619 23.99 1.48 34.59 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1197 1782 5.080337 TCATCTTTCAGAGTAGGTGACAGT 58.920 41.667 0.0 0.0 0.0 3.55
2913 3505 1.731709 CGGAGCACACGAAATCATCAA 59.268 47.619 0.0 0.0 0.0 2.57
3029 3621 0.329596 GTGAGGGGCTGAATTGGACT 59.670 55.000 0.0 0.0 0.0 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.