Multiple sequence alignment - TraesCS2D01G141600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G141600 chr2D 100.000 3206 0 0 1 3206 83187542 83190747 0.000000e+00 5921.0
1 TraesCS2D01G141600 chr2D 95.899 2682 78 16 536 3206 83224896 83227556 0.000000e+00 4314.0
2 TraesCS2D01G141600 chr2D 89.538 1233 85 23 437 1656 127821781 127820580 0.000000e+00 1522.0
3 TraesCS2D01G141600 chr2D 90.667 1050 72 16 1680 2710 83530715 83531757 0.000000e+00 1373.0
4 TraesCS2D01G141600 chr2D 87.003 1131 89 31 1680 2785 127820586 127819489 0.000000e+00 1221.0
5 TraesCS2D01G141600 chr2D 93.784 547 30 3 1 544 83223709 83224254 0.000000e+00 819.0
6 TraesCS2D01G141600 chr2A 93.526 2626 91 16 281 2895 83984445 83987002 0.000000e+00 3834.0
7 TraesCS2D01G141600 chr2A 87.602 1710 135 24 868 2570 86061972 86060333 0.000000e+00 1912.0
8 TraesCS2D01G141600 chr2A 93.333 285 19 0 1 285 83958915 83959199 3.820000e-114 422.0
9 TraesCS2D01G141600 chr2A 94.275 262 7 2 2936 3197 83987003 83987256 8.340000e-106 394.0
10 TraesCS2D01G141600 chr2A 92.400 250 18 1 2855 3104 83992276 83992524 3.930000e-94 355.0
11 TraesCS2D01G141600 chr2A 83.544 158 14 6 614 768 84012618 84012766 1.550000e-28 137.0
12 TraesCS2D01G141600 chr2A 100.000 31 0 0 2870 2900 84147146 84147176 1.240000e-04 58.4
13 TraesCS2D01G141600 chr2A 92.308 39 3 0 511 549 755745425 755745463 4.470000e-04 56.5
14 TraesCS2D01G141600 chr2B 94.347 2512 79 14 711 3197 182153466 182150993 0.000000e+00 3794.0
15 TraesCS2D01G141600 chr2B 91.440 2652 133 45 437 3055 135197657 135200247 0.000000e+00 3554.0
16 TraesCS2D01G141600 chr2B 94.022 2275 78 34 556 2802 135463369 135465613 0.000000e+00 3395.0
17 TraesCS2D01G141600 chr2B 90.990 2464 144 38 692 3118 135357799 135360221 0.000000e+00 3249.0
18 TraesCS2D01G141600 chr2B 90.337 2401 119 45 437 2804 135126301 135128621 0.000000e+00 3044.0
19 TraesCS2D01G141600 chr2B 88.788 1757 140 23 831 2570 137814521 137812805 0.000000e+00 2100.0
20 TraesCS2D01G141600 chr2B 89.167 1717 130 28 871 2570 137349321 137347644 0.000000e+00 2089.0
21 TraesCS2D01G141600 chr2B 88.325 394 26 11 711 1085 182161493 182161101 3.770000e-124 455.0
22 TraesCS2D01G141600 chr2B 91.892 259 21 0 2863 3121 135515489 135515747 2.350000e-96 363.0
23 TraesCS2D01G141600 chr2B 95.620 137 6 0 1 137 135463052 135463188 1.500000e-53 220.0
24 TraesCS2D01G141600 chr2B 80.723 249 35 11 2565 2802 135516643 135516889 7.060000e-42 182.0
25 TraesCS2D01G141600 chr2B 94.118 102 2 1 3105 3206 135360240 135360337 5.540000e-33 152.0
26 TraesCS2D01G141600 chr2B 83.444 151 16 5 614 764 135238829 135238970 7.220000e-27 132.0
27 TraesCS2D01G141600 chr2B 93.258 89 2 2 3118 3206 135215106 135215190 9.340000e-26 128.0
28 TraesCS2D01G141600 chr2B 93.258 89 2 2 3118 3206 135515931 135516015 9.340000e-26 128.0
29 TraesCS2D01G141600 chr5D 90.979 1175 77 21 490 1656 230368704 230369857 0.000000e+00 1555.0
30 TraesCS2D01G141600 chrUn 97.126 870 18 4 2338 3206 25418011 25417148 0.000000e+00 1461.0
31 TraesCS2D01G141600 chrUn 93.784 547 30 3 1 544 333570845 333571390 0.000000e+00 819.0
32 TraesCS2D01G141600 chrUn 93.784 547 30 3 1 544 362504924 362505469 0.000000e+00 819.0
33 TraesCS2D01G141600 chr5A 91.333 1050 54 22 607 1656 326438158 326437146 0.000000e+00 1400.0
34 TraesCS2D01G141600 chr5A 90.891 1010 72 12 1680 2681 326437152 326436155 0.000000e+00 1338.0
35 TraesCS2D01G141600 chr5A 82.682 179 23 7 437 611 326441252 326441078 5.540000e-33 152.0
36 TraesCS2D01G141600 chr6A 100.000 28 0 0 511 538 68141644 68141671 6.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G141600 chr2D 83187542 83190747 3205 False 5921.000000 5921 100.000000 1 3206 1 chr2D.!!$F1 3205
1 TraesCS2D01G141600 chr2D 83223709 83227556 3847 False 2566.500000 4314 94.841500 1 3206 2 chr2D.!!$F3 3205
2 TraesCS2D01G141600 chr2D 83530715 83531757 1042 False 1373.000000 1373 90.667000 1680 2710 1 chr2D.!!$F2 1030
3 TraesCS2D01G141600 chr2D 127819489 127821781 2292 True 1371.500000 1522 88.270500 437 2785 2 chr2D.!!$R1 2348
4 TraesCS2D01G141600 chr2A 83984445 83987256 2811 False 2114.000000 3834 93.900500 281 3197 2 chr2A.!!$F6 2916
5 TraesCS2D01G141600 chr2A 86060333 86061972 1639 True 1912.000000 1912 87.602000 868 2570 1 chr2A.!!$R1 1702
6 TraesCS2D01G141600 chr2B 182150993 182153466 2473 True 3794.000000 3794 94.347000 711 3197 1 chr2B.!!$R3 2486
7 TraesCS2D01G141600 chr2B 135197657 135200247 2590 False 3554.000000 3554 91.440000 437 3055 1 chr2B.!!$F2 2618
8 TraesCS2D01G141600 chr2B 135126301 135128621 2320 False 3044.000000 3044 90.337000 437 2804 1 chr2B.!!$F1 2367
9 TraesCS2D01G141600 chr2B 137812805 137814521 1716 True 2100.000000 2100 88.788000 831 2570 1 chr2B.!!$R2 1739
10 TraesCS2D01G141600 chr2B 137347644 137349321 1677 True 2089.000000 2089 89.167000 871 2570 1 chr2B.!!$R1 1699
11 TraesCS2D01G141600 chr2B 135463052 135465613 2561 False 1807.500000 3395 94.821000 1 2802 2 chr2B.!!$F6 2801
12 TraesCS2D01G141600 chr2B 135357799 135360337 2538 False 1700.500000 3249 92.554000 692 3206 2 chr2B.!!$F5 2514
13 TraesCS2D01G141600 chr2B 135515489 135516889 1400 False 224.333333 363 88.624333 2565 3206 3 chr2B.!!$F7 641
14 TraesCS2D01G141600 chr5D 230368704 230369857 1153 False 1555.000000 1555 90.979000 490 1656 1 chr5D.!!$F1 1166
15 TraesCS2D01G141600 chrUn 25417148 25418011 863 True 1461.000000 1461 97.126000 2338 3206 1 chrUn.!!$R1 868
16 TraesCS2D01G141600 chrUn 333570845 333571390 545 False 819.000000 819 93.784000 1 544 1 chrUn.!!$F1 543
17 TraesCS2D01G141600 chrUn 362504924 362505469 545 False 819.000000 819 93.784000 1 544 1 chrUn.!!$F2 543
18 TraesCS2D01G141600 chr5A 326436155 326441252 5097 True 963.333333 1400 88.302000 437 2681 3 chr5A.!!$R1 2244

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
105 106 0.247460 CTGCGATGACAAGTCCCTCA 59.753 55.000 0.00 0.00 0.0 3.86 F
172 173 0.894184 GTCCTCCTCTGTCGTGGTCA 60.894 60.000 0.00 0.00 0.0 4.02 F
207 208 1.947642 GTCGTGCTATAACCGGCGG 60.948 63.158 27.06 27.06 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2008 5654 1.537202 GGTAAGCAAGTGCAGAACCTG 59.463 52.381 6.00 0.00 45.16 4.00 R
2124 5772 5.970023 GTGGTAACTATGTCGTACACATCTC 59.030 44.000 12.32 3.66 45.23 2.75 R
2260 5915 2.049228 CGTTTTACGCTCTGTCTCGTT 58.951 47.619 0.00 0.00 39.79 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 1.111116 GGTCATCGGTATGGGGACGA 61.111 60.000 0.00 0.00 41.20 4.20
105 106 0.247460 CTGCGATGACAAGTCCCTCA 59.753 55.000 0.00 0.00 0.00 3.86
172 173 0.894184 GTCCTCCTCTGTCGTGGTCA 60.894 60.000 0.00 0.00 0.00 4.02
207 208 1.947642 GTCGTGCTATAACCGGCGG 60.948 63.158 27.06 27.06 0.00 6.13
554 1222 9.727627 GCTTCAGAAATTTATGTGATTTCCTAG 57.272 33.333 12.28 1.55 41.97 3.02
1506 5148 2.964925 GATATTGCCGTCGCCGCA 60.965 61.111 0.00 0.00 0.00 5.69
2008 5654 7.468141 AGTTTCATTTAATCTTTGTCCCTCC 57.532 36.000 0.00 0.00 0.00 4.30
2124 5772 2.314323 AGGCAGCAAAAACCTTGTTG 57.686 45.000 0.00 0.00 34.40 3.33
2149 5797 4.439305 TGTGTACGACATAGTTACCACC 57.561 45.455 0.00 0.00 0.00 4.61
2260 5915 2.236146 ACTCATGTACTGCAATTCCGGA 59.764 45.455 0.00 0.00 0.00 5.14
2836 6551 7.378966 TGAAGACAGACTTTATGGTTACAGAG 58.621 38.462 0.00 0.00 39.13 3.35
3073 6797 2.096819 ACCAAATATTGCGCTTGTACCG 59.903 45.455 9.73 0.00 0.00 4.02
3091 6815 0.667184 CGTTGGGCATTGCTTGGAAC 60.667 55.000 8.82 5.75 0.00 3.62
3165 6922 9.860898 AGAACCTGATGATATTTAAAACTTTGC 57.139 29.630 0.00 0.00 0.00 3.68
3166 6923 9.860898 GAACCTGATGATATTTAAAACTTTGCT 57.139 29.630 0.00 0.00 0.00 3.91
3169 6926 9.438291 CCTGATGATATTTAAAACTTTGCTACG 57.562 33.333 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 3.909662 GCAACATGCGATCCCTGT 58.090 55.556 0.00 0.00 31.71 4.00
105 106 1.296715 GTCTTCATGTGCGAGGGGT 59.703 57.895 0.00 0.00 0.00 4.95
207 208 3.116531 GGTCGTAACACGGCTGGC 61.117 66.667 3.13 0.00 46.79 4.85
544 559 7.122055 ACCGCATAATTGTTTTCTAGGAAATCA 59.878 33.333 0.00 0.00 0.00 2.57
554 1222 6.252655 GGTGTATCAACCGCATAATTGTTTTC 59.747 38.462 0.00 0.00 0.00 2.29
2008 5654 1.537202 GGTAAGCAAGTGCAGAACCTG 59.463 52.381 6.00 0.00 45.16 4.00
2124 5772 5.970023 GTGGTAACTATGTCGTACACATCTC 59.030 44.000 12.32 3.66 45.23 2.75
2260 5915 2.049228 CGTTTTACGCTCTGTCTCGTT 58.951 47.619 0.00 0.00 39.79 3.85
2387 6045 5.275067 GAGAGTCAGCATAGTCTCCAAAT 57.725 43.478 10.58 0.00 39.21 2.32
2836 6551 6.094603 ACCTATTTGACAATCAGATTGCAGTC 59.905 38.462 21.22 12.79 43.98 3.51
3073 6797 0.320683 GGTTCCAAGCAATGCCCAAC 60.321 55.000 0.00 0.00 0.00 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.