Multiple sequence alignment - TraesCS2D01G139900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G139900 chr2D 100.000 2351 0 0 1 2351 82253876 82251526 0.000000e+00 4342
1 TraesCS2D01G139900 chr2D 98.370 184 3 0 1 184 129923196 129923379 8.100000e-85 324
2 TraesCS2D01G139900 chrUn 98.087 2352 26 3 1 2351 134336998 134334665 0.000000e+00 4076
3 TraesCS2D01G139900 chrUn 97.167 1447 23 9 719 2150 24219357 24220800 0.000000e+00 2429
4 TraesCS2D01G139900 chrUn 96.110 694 21 6 1 691 24218688 24219378 0.000000e+00 1127
5 TraesCS2D01G139900 chrUn 99.133 346 3 0 2006 2351 298243234 298243579 7.130000e-175 623
6 TraesCS2D01G139900 chrUn 99.133 346 3 0 2006 2351 321074251 321074596 7.130000e-175 623
7 TraesCS2D01G139900 chr7D 97.479 2380 31 12 1 2351 109452807 109455186 0.000000e+00 4036
8 TraesCS2D01G139900 chr7D 97.936 1308 24 3 777 2081 55628236 55629543 0.000000e+00 2263
9 TraesCS2D01G139900 chr1D 97.059 2380 36 17 1 2351 475686133 475683759 0.000000e+00 3976
10 TraesCS2D01G139900 chr1D 96.992 2194 45 14 176 2351 383669162 383671352 0.000000e+00 3666
11 TraesCS2D01G139900 chr4D 98.720 1719 19 3 635 2351 502616126 502617843 0.000000e+00 3049
12 TraesCS2D01G139900 chr4D 98.807 587 7 0 1 587 502615241 502615827 0.000000e+00 1046
13 TraesCS2D01G139900 chr3D 98.599 1713 22 1 641 2351 579341997 579343709 0.000000e+00 3029
14 TraesCS2D01G139900 chr3D 98.125 1387 25 1 777 2162 119268404 119269790 0.000000e+00 2416
15 TraesCS2D01G139900 chr3D 96.224 715 21 6 1 712 119267070 119267781 0.000000e+00 1166
16 TraesCS2D01G139900 chr3D 99.136 579 4 1 1 579 579341220 579341797 0.000000e+00 1040
17 TraesCS2D01G139900 chr3A 95.113 532 21 5 183 712 493668997 493668469 0.000000e+00 833
18 TraesCS2D01G139900 chr5D 98.936 188 2 0 2164 2351 28008477 28008290 1.040000e-88 337
19 TraesCS2D01G139900 chr5D 98.370 184 3 0 1 184 259635321 259635138 8.100000e-85 324


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G139900 chr2D 82251526 82253876 2350 True 4342.0 4342 100.0000 1 2351 1 chr2D.!!$R1 2350
1 TraesCS2D01G139900 chrUn 134334665 134336998 2333 True 4076.0 4076 98.0870 1 2351 1 chrUn.!!$R1 2350
2 TraesCS2D01G139900 chrUn 24218688 24220800 2112 False 1778.0 2429 96.6385 1 2150 2 chrUn.!!$F3 2149
3 TraesCS2D01G139900 chr7D 109452807 109455186 2379 False 4036.0 4036 97.4790 1 2351 1 chr7D.!!$F2 2350
4 TraesCS2D01G139900 chr7D 55628236 55629543 1307 False 2263.0 2263 97.9360 777 2081 1 chr7D.!!$F1 1304
5 TraesCS2D01G139900 chr1D 475683759 475686133 2374 True 3976.0 3976 97.0590 1 2351 1 chr1D.!!$R1 2350
6 TraesCS2D01G139900 chr1D 383669162 383671352 2190 False 3666.0 3666 96.9920 176 2351 1 chr1D.!!$F1 2175
7 TraesCS2D01G139900 chr4D 502615241 502617843 2602 False 2047.5 3049 98.7635 1 2351 2 chr4D.!!$F1 2350
8 TraesCS2D01G139900 chr3D 579341220 579343709 2489 False 2034.5 3029 98.8675 1 2351 2 chr3D.!!$F2 2350
9 TraesCS2D01G139900 chr3D 119267070 119269790 2720 False 1791.0 2416 97.1745 1 2162 2 chr3D.!!$F1 2161
10 TraesCS2D01G139900 chr3A 493668469 493668997 528 True 833.0 833 95.1130 183 712 1 chr3A.!!$R1 529

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
978 1790 0.835276 CATCCTCCTCTCACATGGCA 59.165 55.0 0.0 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1779 2600 3.302434 CGCGTGAAAAGCTAACTTCGATA 59.698 43.478 0.0 0.0 39.95 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
272 274 2.935201 AGAGCTCGAATGAAATCAGCAC 59.065 45.455 8.37 0.0 0.00 4.40
603 649 6.761099 TCAAGCGGGCAAGTAAATAAATAA 57.239 33.333 0.00 0.0 0.00 1.40
604 650 7.159322 TCAAGCGGGCAAGTAAATAAATAAA 57.841 32.000 0.00 0.0 0.00 1.40
605 651 7.777095 TCAAGCGGGCAAGTAAATAAATAAAT 58.223 30.769 0.00 0.0 0.00 1.40
606 652 8.904834 TCAAGCGGGCAAGTAAATAAATAAATA 58.095 29.630 0.00 0.0 0.00 1.40
607 653 9.691362 CAAGCGGGCAAGTAAATAAATAAATAT 57.309 29.630 0.00 0.0 0.00 1.28
978 1790 0.835276 CATCCTCCTCTCACATGGCA 59.165 55.000 0.00 0.0 0.00 4.92
1233 2051 6.278363 GGGTACTAGCAACGATCAAATTCTA 58.722 40.000 0.00 0.0 0.00 2.10
1547 2366 2.093306 TGAGATTTGTCGCCGAACAT 57.907 45.000 0.00 0.0 0.00 2.71
1552 2371 0.793861 TTTGTCGCCGAACATGCTAC 59.206 50.000 0.00 0.0 0.00 3.58
1651 2472 6.039616 ACAAATGTCATTTACTGCGTTTGTT 58.960 32.000 10.46 0.0 42.17 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
311 313 4.775253 TGTCATGTGTGGTCCATTACTCTA 59.225 41.667 0.0 0.0 0.00 2.43
978 1790 6.627243 CATGTGAATTGAACTGTTGGATGAT 58.373 36.000 0.0 0.0 0.00 2.45
1233 2051 1.073897 GCTCTCCTTGGTTGCCTGT 59.926 57.895 0.0 0.0 0.00 4.00
1779 2600 3.302434 CGCGTGAAAAGCTAACTTCGATA 59.698 43.478 0.0 0.0 39.95 2.92
2162 2986 5.241403 TCGCCTGTGAATCCCATATATTT 57.759 39.130 0.0 0.0 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.