Multiple sequence alignment - TraesCS2D01G139800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G139800 chr2D 100.000 4112 0 0 1 4112 82250615 82246504 0 7594
1 TraesCS2D01G139800 chr4D 99.198 4113 30 2 1 4112 502618755 502622865 0 7409
2 TraesCS2D01G139800 chr3D 99.125 4113 32 3 1 4112 579344620 579348729 0 7393
3 TraesCS2D01G139800 chrUn 99.100 4113 33 3 1 4112 134333754 134329645 0 7387
4 TraesCS2D01G139800 chr3B 96.396 3135 111 1 3 3137 728851301 728854433 0 5162
5 TraesCS2D01G139800 chr6B 95.609 3143 127 7 3 3137 646100962 646104101 0 5029
6 TraesCS2D01G139800 chr1A 96.163 2580 94 4 475 3051 394485024 394487601 0 4211
7 TraesCS2D01G139800 chr1A 95.947 2344 91 3 710 3051 394415106 394417447 0 3799
8 TraesCS2D01G139800 chr5A 95.130 2546 118 5 475 3016 542029676 542027133 0 4010
9 TraesCS2D01G139800 chr4B 94.600 2111 103 8 907 3015 524149752 524147651 0 3256
10 TraesCS2D01G139800 chr4B 96.680 964 31 1 3148 4111 669430221 669431183 0 1602
11 TraesCS2D01G139800 chr4B 96.058 964 37 1 3148 4111 669203781 669202819 0 1568
12 TraesCS2D01G139800 chr4B 95.963 966 38 1 3146 4111 668306521 668307485 0 1567
13 TraesCS2D01G139800 chr4B 95.747 964 40 1 3148 4111 669392463 669391501 0 1552
14 TraesCS2D01G139800 chr7D 98.716 1713 18 3 1 1711 109456097 109457807 0 3038
15 TraesCS2D01G139800 chr7D 99.146 1405 11 1 2708 4112 109457801 109459204 0 2527
16 TraesCS2D01G139800 chr5D 99.313 1165 7 1 2948 4112 531438778 531437615 0 2106


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G139800 chr2D 82246504 82250615 4111 True 7594.0 7594 100.000 1 4112 1 chr2D.!!$R1 4111
1 TraesCS2D01G139800 chr4D 502618755 502622865 4110 False 7409.0 7409 99.198 1 4112 1 chr4D.!!$F1 4111
2 TraesCS2D01G139800 chr3D 579344620 579348729 4109 False 7393.0 7393 99.125 1 4112 1 chr3D.!!$F1 4111
3 TraesCS2D01G139800 chrUn 134329645 134333754 4109 True 7387.0 7387 99.100 1 4112 1 chrUn.!!$R1 4111
4 TraesCS2D01G139800 chr3B 728851301 728854433 3132 False 5162.0 5162 96.396 3 3137 1 chr3B.!!$F1 3134
5 TraesCS2D01G139800 chr6B 646100962 646104101 3139 False 5029.0 5029 95.609 3 3137 1 chr6B.!!$F1 3134
6 TraesCS2D01G139800 chr1A 394485024 394487601 2577 False 4211.0 4211 96.163 475 3051 1 chr1A.!!$F2 2576
7 TraesCS2D01G139800 chr1A 394415106 394417447 2341 False 3799.0 3799 95.947 710 3051 1 chr1A.!!$F1 2341
8 TraesCS2D01G139800 chr5A 542027133 542029676 2543 True 4010.0 4010 95.130 475 3016 1 chr5A.!!$R1 2541
9 TraesCS2D01G139800 chr4B 524147651 524149752 2101 True 3256.0 3256 94.600 907 3015 1 chr4B.!!$R1 2108
10 TraesCS2D01G139800 chr4B 669430221 669431183 962 False 1602.0 1602 96.680 3148 4111 1 chr4B.!!$F2 963
11 TraesCS2D01G139800 chr4B 669202819 669203781 962 True 1568.0 1568 96.058 3148 4111 1 chr4B.!!$R2 963
12 TraesCS2D01G139800 chr4B 668306521 668307485 964 False 1567.0 1567 95.963 3146 4111 1 chr4B.!!$F1 965
13 TraesCS2D01G139800 chr4B 669391501 669392463 962 True 1552.0 1552 95.747 3148 4111 1 chr4B.!!$R3 963
14 TraesCS2D01G139800 chr7D 109456097 109459204 3107 False 2782.5 3038 98.931 1 4112 2 chr7D.!!$F1 4111
15 TraesCS2D01G139800 chr5D 531437615 531438778 1163 True 2106.0 2106 99.313 2948 4112 1 chr5D.!!$R1 1164

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
185 186 1.550524 ACGCCTAAGTCAAGAGCATGA 59.449 47.619 0.00 0.0 0.00 3.07 F
547 549 3.920446 ACTTTGTTTTTCAACACGGCTT 58.080 36.364 0.00 0.0 42.87 4.35 F
882 887 6.738352 TCTACGTCTTAAAAACGACTTGAC 57.262 37.500 14.85 0.0 42.62 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2539 2551 1.528586 CCGAGTCTTTGCTGTGACAAG 59.471 52.381 0.0 0.0 35.81 3.16 R
2854 2866 4.039973 TGATTGAAGTACTCCTGACGGTTT 59.960 41.667 0.0 0.0 0.00 3.27 R
3198 3211 5.361427 TGTGAGTGAGATTGTTTTTACGGA 58.639 37.500 0.0 0.0 0.00 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 186 1.550524 ACGCCTAAGTCAAGAGCATGA 59.449 47.619 0.00 0.0 0.00 3.07
547 549 3.920446 ACTTTGTTTTTCAACACGGCTT 58.080 36.364 0.00 0.0 42.87 4.35
882 887 6.738352 TCTACGTCTTAAAAACGACTTGAC 57.262 37.500 14.85 0.0 42.62 3.18
904 909 7.337167 TGACATATTTGGCAGGCAATAAAAAT 58.663 30.769 10.74 3.2 35.35 1.82
3198 3211 1.043116 TGAGGGGTCGAGCGAATCAT 61.043 55.000 8.77 0.0 0.00 2.45
3217 3230 7.413000 CGAATCATCCGTAAAAACAATCTCACT 60.413 37.037 0.00 0.0 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 186 0.321298 GTGGTACAAGTGGCGACCAT 60.321 55.000 0.00 0.00 43.61 3.55
192 193 2.146342 CTCTGCAAGTGGTACAAGTGG 58.854 52.381 0.00 0.00 44.16 4.00
547 549 4.632688 CCGAGGGAAACGAGCTTTTTATTA 59.367 41.667 0.00 0.00 0.00 0.98
818 823 1.603236 AAACGTGACGGGGGCGTATA 61.603 55.000 10.66 0.00 37.92 1.47
882 887 7.789273 TGATTTTTATTGCCTGCCAAATATG 57.211 32.000 0.00 0.00 36.92 1.78
926 931 7.530426 AGGATGTCGATGCAGCATATATATA 57.470 36.000 8.22 0.00 0.00 0.86
927 932 6.416631 AGGATGTCGATGCAGCATATATAT 57.583 37.500 8.22 3.16 0.00 0.86
2539 2551 1.528586 CCGAGTCTTTGCTGTGACAAG 59.471 52.381 0.00 0.00 35.81 3.16
2854 2866 4.039973 TGATTGAAGTACTCCTGACGGTTT 59.960 41.667 0.00 0.00 0.00 3.27
3198 3211 5.361427 TGTGAGTGAGATTGTTTTTACGGA 58.639 37.500 0.00 0.00 0.00 4.69
3217 3230 5.710567 CGTAGGGTAGGAGATATGATTGTGA 59.289 44.000 0.00 0.00 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.