Multiple sequence alignment - TraesCS2D01G124100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G124100 chr2D 100.000 4653 0 0 1 4653 72657206 72652554 0.000000e+00 8593.0
1 TraesCS2D01G124100 chr2D 98.282 4656 36 6 1 4653 72376708 72372094 0.000000e+00 8115.0
2 TraesCS2D01G124100 chr2A 93.335 3961 167 18 127 4066 71214678 71210794 0.000000e+00 5762.0
3 TraesCS2D01G124100 chr2A 92.350 3961 184 28 127 4066 71161896 71158034 0.000000e+00 5526.0
4 TraesCS2D01G124100 chr2A 94.290 2977 133 11 1105 4066 71315305 71312351 0.000000e+00 4521.0
5 TraesCS2D01G124100 chr2A 90.658 2355 119 25 127 2474 71120595 71118335 0.000000e+00 3037.0
6 TraesCS2D01G124100 chr2A 97.237 1665 42 1 2464 4128 71115899 71114239 0.000000e+00 2817.0
7 TraesCS2D01G124100 chr2A 94.865 1480 38 9 1372 2851 71265189 71263748 0.000000e+00 2278.0
8 TraesCS2D01G124100 chr2A 89.434 918 54 11 127 1038 71316208 71315328 0.000000e+00 1118.0
9 TraesCS2D01G124100 chr2A 97.719 526 11 1 4128 4653 71113828 71113304 0.000000e+00 904.0
10 TraesCS2D01G124100 chr2A 89.000 600 55 7 4060 4652 71079300 71078705 0.000000e+00 732.0
11 TraesCS2D01G124100 chr2A 92.698 315 16 2 3759 4066 71263737 71263423 9.180000e-122 448.0
12 TraesCS2D01G124100 chrUn 93.310 3961 168 20 127 4066 289663044 289659160 0.000000e+00 5757.0
13 TraesCS2D01G124100 chrUn 95.027 3278 123 14 129 3405 235541493 235544731 0.000000e+00 5114.0
14 TraesCS2D01G124100 chrUn 95.027 3278 123 13 129 3405 256966546 256963308 0.000000e+00 5114.0
15 TraesCS2D01G124100 chrUn 95.027 3278 123 13 129 3405 271157591 271154353 0.000000e+00 5114.0
16 TraesCS2D01G124100 chrUn 93.238 1745 61 10 546 2289 379030677 379032365 0.000000e+00 2516.0
17 TraesCS2D01G124100 chrUn 85.606 132 9 3 4 125 235541326 235541457 3.780000e-26 130.0
18 TraesCS2D01G124100 chrUn 85.606 132 9 3 4 125 256966713 256966582 3.780000e-26 130.0
19 TraesCS2D01G124100 chrUn 85.606 132 9 3 4 125 271157758 271157627 3.780000e-26 130.0
20 TraesCS2D01G124100 chr2B 94.923 2521 97 8 129 2648 109184546 109182056 0.000000e+00 3917.0
21 TraesCS2D01G124100 chr2B 94.057 2541 100 10 129 2666 109093521 109091029 0.000000e+00 3808.0
22 TraesCS2D01G124100 chr2B 93.777 2523 105 9 129 2648 109872921 109870448 0.000000e+00 3742.0
23 TraesCS2D01G124100 chr2B 95.497 1732 55 6 2701 4431 109182060 109180351 0.000000e+00 2745.0
24 TraesCS2D01G124100 chr2B 96.766 1608 50 2 2701 4307 109870452 109868846 0.000000e+00 2680.0
25 TraesCS2D01G124100 chr2B 92.897 1605 87 5 2067 3669 109360130 109358551 0.000000e+00 2307.0
26 TraesCS2D01G124100 chr2B 95.015 1304 55 3 2859 4152 109085401 109084098 0.000000e+00 2039.0
27 TraesCS2D01G124100 chr2B 95.927 491 17 2 4165 4653 109083893 109083404 0.000000e+00 793.0
28 TraesCS2D01G124100 chr2B 97.009 234 5 2 4422 4653 109790461 109790228 4.360000e-105 392.0
29 TraesCS2D01G124100 chr2B 96.983 232 7 0 4422 4653 109162887 109162656 1.570000e-104 390.0
30 TraesCS2D01G124100 chr2B 87.313 134 7 3 4 127 109184713 109184580 1.350000e-30 145.0
31 TraesCS2D01G124100 chr2B 85.075 134 10 6 4 127 109873088 109872955 1.360000e-25 128.0
32 TraesCS2D01G124100 chr6D 85.965 57 3 3 74 130 68021120 68021069 6.500000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G124100 chr2D 72652554 72657206 4652 True 8593.000000 8593 100.000000 1 4653 1 chr2D.!!$R2 4652
1 TraesCS2D01G124100 chr2D 72372094 72376708 4614 True 8115.000000 8115 98.282000 1 4653 1 chr2D.!!$R1 4652
2 TraesCS2D01G124100 chr2A 71210794 71214678 3884 True 5762.000000 5762 93.335000 127 4066 1 chr2A.!!$R3 3939
3 TraesCS2D01G124100 chr2A 71158034 71161896 3862 True 5526.000000 5526 92.350000 127 4066 1 chr2A.!!$R2 3939
4 TraesCS2D01G124100 chr2A 71312351 71316208 3857 True 2819.500000 4521 91.862000 127 4066 2 chr2A.!!$R6 3939
5 TraesCS2D01G124100 chr2A 71113304 71120595 7291 True 2252.666667 3037 95.204667 127 4653 3 chr2A.!!$R4 4526
6 TraesCS2D01G124100 chr2A 71263423 71265189 1766 True 1363.000000 2278 93.781500 1372 4066 2 chr2A.!!$R5 2694
7 TraesCS2D01G124100 chr2A 71078705 71079300 595 True 732.000000 732 89.000000 4060 4652 1 chr2A.!!$R1 592
8 TraesCS2D01G124100 chrUn 289659160 289663044 3884 True 5757.000000 5757 93.310000 127 4066 1 chrUn.!!$R1 3939
9 TraesCS2D01G124100 chrUn 235541326 235544731 3405 False 2622.000000 5114 90.316500 4 3405 2 chrUn.!!$F2 3401
10 TraesCS2D01G124100 chrUn 256963308 256966713 3405 True 2622.000000 5114 90.316500 4 3405 2 chrUn.!!$R2 3401
11 TraesCS2D01G124100 chrUn 271154353 271157758 3405 True 2622.000000 5114 90.316500 4 3405 2 chrUn.!!$R3 3401
12 TraesCS2D01G124100 chrUn 379030677 379032365 1688 False 2516.000000 2516 93.238000 546 2289 1 chrUn.!!$F1 1743
13 TraesCS2D01G124100 chr2B 109091029 109093521 2492 True 3808.000000 3808 94.057000 129 2666 1 chr2B.!!$R1 2537
14 TraesCS2D01G124100 chr2B 109358551 109360130 1579 True 2307.000000 2307 92.897000 2067 3669 1 chr2B.!!$R3 1602
15 TraesCS2D01G124100 chr2B 109180351 109184713 4362 True 2269.000000 3917 92.577667 4 4431 3 chr2B.!!$R6 4427
16 TraesCS2D01G124100 chr2B 109868846 109873088 4242 True 2183.333333 3742 91.872667 4 4307 3 chr2B.!!$R7 4303
17 TraesCS2D01G124100 chr2B 109083404 109085401 1997 True 1416.000000 2039 95.471000 2859 4653 2 chr2B.!!$R5 1794

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
714 763 4.339814 AGTTTCCTTAACAAACGGCAATGA 59.660 37.500 0.0 0.0 38.54 2.57 F
2065 2125 5.973899 TGATGCAAAGTATGGCTACAAAA 57.026 34.783 0.0 0.0 0.00 2.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2194 2254 3.312890 ACAGCTATACCTCTCCAGCATT 58.687 45.455 0.0 0.0 36.47 3.56 R
3761 6306 1.006337 CCCACCGGCAACAACATTG 60.006 57.895 0.0 0.0 0.00 2.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
714 763 4.339814 AGTTTCCTTAACAAACGGCAATGA 59.660 37.500 0.00 0.0 38.54 2.57
2065 2125 5.973899 TGATGCAAAGTATGGCTACAAAA 57.026 34.783 0.00 0.0 0.00 2.44
2194 2254 5.989777 GCTAGAACTTTGGAGTTGTTGACTA 59.010 40.000 0.00 0.0 45.88 2.59
2798 5325 7.391148 TCTTCTCTGCATATTAAACAAACCC 57.609 36.000 0.00 0.0 0.00 4.11
2934 5461 4.644498 CCAAATTTTGGCAACCTGAAGAT 58.356 39.130 14.96 0.0 45.17 2.40
2977 5504 1.527034 TGACTGCAGACTTTGATGCC 58.473 50.000 23.35 0.0 41.85 4.40
3316 5845 4.378978 CGAGAAAATTTATGTCCGCCACAA 60.379 41.667 0.00 0.0 38.97 3.33
3539 6068 8.364129 TGTTAAATTGGAAGAATGTTTTGCTC 57.636 30.769 0.00 0.0 0.00 4.26
3631 6176 0.036732 TCCGCAACCAGAAGCAGATT 59.963 50.000 0.00 0.0 0.00 2.40
3761 6306 4.977963 CGTTGGTGATAATTGGATCATTGC 59.022 41.667 0.00 0.0 38.11 3.56
3930 6475 3.000041 CGTTGTGCTATGCTCCAGTAAA 59.000 45.455 0.00 0.0 0.00 2.01
3980 6532 4.632688 GGCTTTAGTACCGTGCAAATTCTA 59.367 41.667 0.00 0.0 0.00 2.10
4037 6589 1.330521 CCGGCGATGAAGGTTTACATG 59.669 52.381 9.30 0.0 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2194 2254 3.312890 ACAGCTATACCTCTCCAGCATT 58.687 45.455 0.0 0.0 36.47 3.56
2934 5461 2.038952 CACCATTCACCAAGAGACAGGA 59.961 50.000 0.0 0.0 0.00 3.86
3316 5845 1.367840 GACTCACAAGCACTCCCGT 59.632 57.895 0.0 0.0 0.00 5.28
3539 6068 6.931838 TGTACAGGAGGAACATAGTTAAGTG 58.068 40.000 0.0 0.0 0.00 3.16
3631 6176 2.661176 ACATCCCCCAGAACTCCTTA 57.339 50.000 0.0 0.0 0.00 2.69
3761 6306 1.006337 CCCACCGGCAACAACATTG 60.006 57.895 0.0 0.0 0.00 2.82
3930 6475 3.795688 AACTCACCACAGGATCAATGT 57.204 42.857 0.0 0.0 0.00 2.71
3980 6532 6.264518 AGGTTCATTTCCTTTTACACGACATT 59.735 34.615 0.0 0.0 30.18 2.71
4037 6589 6.817140 ACCGAAATCTGAATAGTTAGACAACC 59.183 38.462 0.0 0.0 35.05 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.