Multiple sequence alignment - TraesCS2D01G116000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G116000 chr2D 100.000 2551 0 0 1 2551 64508130 64510680 0 4711
1 TraesCS2D01G116000 chrUn 96.235 1992 67 3 566 2551 60558708 60560697 0 3256
2 TraesCS2D01G116000 chr5B 96.123 1986 68 6 569 2551 26059378 26057399 0 3232
3 TraesCS2D01G116000 chr3B 95.930 1990 70 7 565 2551 53523439 53525420 0 3216
4 TraesCS2D01G116000 chr3B 95.674 1988 77 8 569 2551 687040066 687042049 0 3186
5 TraesCS2D01G116000 chr3B 95.173 1989 83 7 565 2551 804661029 804663006 0 3129
6 TraesCS2D01G116000 chr1B 95.672 1987 78 5 569 2551 542264940 542266922 0 3186
7 TraesCS2D01G116000 chr2B 95.537 1994 69 13 563 2551 546410279 546412257 0 3171
8 TraesCS2D01G116000 chr2B 94.787 1995 83 11 565 2551 666075778 666073797 0 3088
9 TraesCS2D01G116000 chr4B 95.217 1986 88 5 569 2551 645967796 645965815 0 3134
10 TraesCS2D01G116000 chr5D 97.028 572 16 1 1 571 119449018 119449589 0 961
11 TraesCS2D01G116000 chr5D 95.455 572 25 1 1 571 225089954 225089383 0 911
12 TraesCS2D01G116000 chr5D 95.455 572 25 1 1 571 465963369 465962798 0 911
13 TraesCS2D01G116000 chr3D 96.154 572 18 2 1 571 272427710 272427142 0 931
14 TraesCS2D01G116000 chr1D 95.804 572 23 1 1 571 32791257 32791828 0 922
15 TraesCS2D01G116000 chr1D 95.760 566 24 0 1 566 318606452 318607017 0 913
16 TraesCS2D01G116000 chr1D 95.455 572 25 1 1 571 32799388 32799959 0 911
17 TraesCS2D01G116000 chr1D 94.930 572 28 1 1 571 186064989 186064418 0 894
18 TraesCS2D01G116000 chr3A 95.105 572 27 1 1 571 529964471 529965042 0 900


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G116000 chr2D 64508130 64510680 2550 False 4711 4711 100.000 1 2551 1 chr2D.!!$F1 2550
1 TraesCS2D01G116000 chrUn 60558708 60560697 1989 False 3256 3256 96.235 566 2551 1 chrUn.!!$F1 1985
2 TraesCS2D01G116000 chr5B 26057399 26059378 1979 True 3232 3232 96.123 569 2551 1 chr5B.!!$R1 1982
3 TraesCS2D01G116000 chr3B 53523439 53525420 1981 False 3216 3216 95.930 565 2551 1 chr3B.!!$F1 1986
4 TraesCS2D01G116000 chr3B 687040066 687042049 1983 False 3186 3186 95.674 569 2551 1 chr3B.!!$F2 1982
5 TraesCS2D01G116000 chr3B 804661029 804663006 1977 False 3129 3129 95.173 565 2551 1 chr3B.!!$F3 1986
6 TraesCS2D01G116000 chr1B 542264940 542266922 1982 False 3186 3186 95.672 569 2551 1 chr1B.!!$F1 1982
7 TraesCS2D01G116000 chr2B 546410279 546412257 1978 False 3171 3171 95.537 563 2551 1 chr2B.!!$F1 1988
8 TraesCS2D01G116000 chr2B 666073797 666075778 1981 True 3088 3088 94.787 565 2551 1 chr2B.!!$R1 1986
9 TraesCS2D01G116000 chr4B 645965815 645967796 1981 True 3134 3134 95.217 569 2551 1 chr4B.!!$R1 1982
10 TraesCS2D01G116000 chr5D 119449018 119449589 571 False 961 961 97.028 1 571 1 chr5D.!!$F1 570
11 TraesCS2D01G116000 chr5D 225089383 225089954 571 True 911 911 95.455 1 571 1 chr5D.!!$R1 570
12 TraesCS2D01G116000 chr5D 465962798 465963369 571 True 911 911 95.455 1 571 1 chr5D.!!$R2 570
13 TraesCS2D01G116000 chr3D 272427142 272427710 568 True 931 931 96.154 1 571 1 chr3D.!!$R1 570
14 TraesCS2D01G116000 chr1D 32791257 32791828 571 False 922 922 95.804 1 571 1 chr1D.!!$F1 570
15 TraesCS2D01G116000 chr1D 318606452 318607017 565 False 913 913 95.760 1 566 1 chr1D.!!$F3 565
16 TraesCS2D01G116000 chr1D 32799388 32799959 571 False 911 911 95.455 1 571 1 chr1D.!!$F2 570
17 TraesCS2D01G116000 chr1D 186064418 186064989 571 True 894 894 94.930 1 571 1 chr1D.!!$R1 570
18 TraesCS2D01G116000 chr3A 529964471 529965042 571 False 900 900 95.105 1 571 1 chr3A.!!$F1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
351 352 0.037734 GTCCCACTTCCATTCGGGTT 59.962 55.0 0.0 0.0 39.87 4.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2043 2054 1.483827 CTCTTGCCATCTGTCCTAGCA 59.516 52.381 0.0 0.0 0.0 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 4.083565 GCATAGGTGGTTTTTACTGGGAA 58.916 43.478 0.00 0.00 0.00 3.97
233 234 4.709886 GCATAGGTGGTTTTTACTGGGAAT 59.290 41.667 0.00 0.00 0.00 3.01
351 352 0.037734 GTCCCACTTCCATTCGGGTT 59.962 55.000 0.00 0.00 39.87 4.11
390 391 0.251354 TCCTGCTGGCTTCTGATGTC 59.749 55.000 4.42 0.00 0.00 3.06
423 424 6.365518 CACTCTCTGACATACATCACATATGC 59.634 42.308 1.58 0.00 33.99 3.14
466 467 2.568956 TCTTCATTCCAGTCCACCAGAG 59.431 50.000 0.00 0.00 0.00 3.35
615 616 2.887152 GGTGTCCATCTGCTCAGTTTTT 59.113 45.455 0.00 0.00 0.00 1.94
694 695 0.179067 TGAACTTTGGCGTCTCCGTT 60.179 50.000 0.00 0.00 37.80 4.44
967 970 1.976132 GCTAGCTGTGGAGGGCATGA 61.976 60.000 7.70 0.00 0.00 3.07
1347 1350 4.196778 TGCCCCAAACCGCAGTGA 62.197 61.111 0.00 0.00 0.00 3.41
1734 1745 9.471084 TCAATGAAATGCAGCTAATGAATTATG 57.529 29.630 0.00 0.00 35.98 1.90
1763 1774 8.306761 AGAGCCAAACAATTAAGGTTAGAAATG 58.693 33.333 0.00 0.00 0.00 2.32
1764 1775 6.873605 AGCCAAACAATTAAGGTTAGAAATGC 59.126 34.615 0.00 0.00 0.00 3.56
2043 2054 1.550130 TTAGGGCTGCGCTGGTAACT 61.550 55.000 27.01 3.65 37.61 2.24
2103 2114 7.379750 GGAAGGAATGTATACATAGTGAGACC 58.620 42.308 18.56 12.03 35.10 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 7.614192 ACTTATTCCCAGTAAAAACCACCTATG 59.386 37.037 0.00 0.00 0.00 2.23
256 257 7.996788 TGATTCTATCTGGGTAGTAGTGGATA 58.003 38.462 0.00 0.00 0.00 2.59
390 391 0.972134 TGTCAGAGAGTGAAGGCAGG 59.028 55.000 0.00 0.00 36.74 4.85
423 424 2.365617 AGGACATTGCCGAGTATGTAGG 59.634 50.000 0.00 0.00 35.24 3.18
466 467 4.394920 TGTATTTGGATTTGAAGGAGCGTC 59.605 41.667 0.00 0.00 0.00 5.19
886 889 3.058773 TGCTCTCGCACTCTCGCT 61.059 61.111 0.00 0.00 42.25 4.93
967 970 2.830704 GAACGGGATCTCAACGCCGT 62.831 60.000 5.75 5.75 36.47 5.68
1048 1051 3.190849 CAGGCATCTCCACACGCG 61.191 66.667 3.53 3.53 37.29 6.01
1049 1052 2.046892 ACAGGCATCTCCACACGC 60.047 61.111 0.00 0.00 37.29 5.34
1396 1399 1.925229 CTCAACAGCTAGCTCTCTGC 58.075 55.000 16.15 4.35 43.29 4.26
1734 1745 2.562738 ACCTTAATTGTTTGGCTCTGGC 59.437 45.455 0.00 0.00 37.82 4.85
1950 1961 1.686052 TGTGCATTTTCCACCCTTCAC 59.314 47.619 0.00 0.00 32.30 3.18
2043 2054 1.483827 CTCTTGCCATCTGTCCTAGCA 59.516 52.381 0.00 0.00 0.00 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.