Multiple sequence alignment - TraesCS2D01G114700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G114700 chr2D 100.000 2321 0 0 1 2321 63681703 63684023 0 4287
1 TraesCS2D01G114700 chr7D 97.708 2269 50 2 54 2321 463977644 463979911 0 3901
2 TraesCS2D01G114700 chr5D 96.989 2325 63 6 1 2321 60521633 60519312 0 3899
3 TraesCS2D01G114700 chr6D 96.852 2319 70 3 1 2318 80673023 80670707 0 3875
4 TraesCS2D01G114700 chr3A 96.134 2328 82 7 1 2321 328922655 328924981 0 3794
5 TraesCS2D01G114700 chr2B 95.851 2314 88 6 1 2308 90758835 90761146 0 3735
6 TraesCS2D01G114700 chr2B 95.531 2327 96 6 1 2321 631382569 631380245 0 3714
7 TraesCS2D01G114700 chr1B 95.808 2314 90 5 1 2308 618191032 618188720 0 3729
8 TraesCS2D01G114700 chr1B 95.767 2315 90 6 1 2308 615476931 615479244 0 3725
9 TraesCS2D01G114700 chr7B 95.722 2314 92 5 1 2308 678100715 678103027 0 3718


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G114700 chr2D 63681703 63684023 2320 False 4287 4287 100.000 1 2321 1 chr2D.!!$F1 2320
1 TraesCS2D01G114700 chr7D 463977644 463979911 2267 False 3901 3901 97.708 54 2321 1 chr7D.!!$F1 2267
2 TraesCS2D01G114700 chr5D 60519312 60521633 2321 True 3899 3899 96.989 1 2321 1 chr5D.!!$R1 2320
3 TraesCS2D01G114700 chr6D 80670707 80673023 2316 True 3875 3875 96.852 1 2318 1 chr6D.!!$R1 2317
4 TraesCS2D01G114700 chr3A 328922655 328924981 2326 False 3794 3794 96.134 1 2321 1 chr3A.!!$F1 2320
5 TraesCS2D01G114700 chr2B 90758835 90761146 2311 False 3735 3735 95.851 1 2308 1 chr2B.!!$F1 2307
6 TraesCS2D01G114700 chr2B 631380245 631382569 2324 True 3714 3714 95.531 1 2321 1 chr2B.!!$R1 2320
7 TraesCS2D01G114700 chr1B 618188720 618191032 2312 True 3729 3729 95.808 1 2308 1 chr1B.!!$R1 2307
8 TraesCS2D01G114700 chr1B 615476931 615479244 2313 False 3725 3725 95.767 1 2308 1 chr1B.!!$F1 2307
9 TraesCS2D01G114700 chr7B 678100715 678103027 2312 False 3718 3718 95.722 1 2308 1 chr7B.!!$F1 2307

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
337 348 0.482446 TTTGAGAGGCCACAACCCAT 59.518 50.0 5.01 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2271 2290 0.741221 GGACGAGCGGAAGAAAGCAT 60.741 55.0 0.0 0.0 35.48 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
337 348 0.482446 TTTGAGAGGCCACAACCCAT 59.518 50.000 5.01 0.0 0.00 4.00
440 451 1.064003 ACACCACCATGGCTGAACTA 58.936 50.000 13.04 0.0 42.67 2.24
536 547 3.263425 ACCGTCACTTTGGAGGATATTGT 59.737 43.478 0.00 0.0 0.00 2.71
545 556 7.501559 CACTTTGGAGGATATTGTGATGATCTT 59.498 37.037 0.00 0.0 0.00 2.40
721 732 5.751243 ACAAGAACATTTTTACGAGTGCT 57.249 34.783 0.00 0.0 0.00 4.40
801 813 3.935818 TTGACCCAAGTGTGTTTCCTA 57.064 42.857 0.00 0.0 0.00 2.94
1008 1022 0.390860 ACGGAGCATGTATGAGGAGC 59.609 55.000 0.00 0.0 0.00 4.70
1028 1042 2.589014 CAAGCCGAAATCTTGTCTTGC 58.411 47.619 0.00 0.0 36.93 4.01
1082 1096 3.792736 GCGTATCCCTGTGGGCCA 61.793 66.667 0.00 0.0 43.94 5.36
1566 1584 9.454859 TTGTACCATATGTTGATCAATGTGTAA 57.545 29.630 12.12 0.0 0.00 2.41
2271 2290 5.564848 GCACGTGCTCAGTATAGAATGGATA 60.565 44.000 32.55 0.0 38.21 2.59
2297 2316 0.173481 CTTCCGCTCGTCCATCTTCA 59.827 55.000 0.00 0.0 0.00 3.02
2308 2327 1.202915 TCCATCTTCAAGCCAAGCACA 60.203 47.619 0.00 0.0 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
337 348 3.056821 CGGTCATACTTCAAGGACTCACA 60.057 47.826 0.00 0.00 0.00 3.58
536 547 4.697514 GATCGGAAGACCAAAGATCATCA 58.302 43.478 0.00 0.00 46.97 3.07
545 556 1.956629 GCCCTCGATCGGAAGACCAA 61.957 60.000 16.41 0.00 46.97 3.67
721 732 1.900351 CCGGACTGGCATTCTCTGA 59.100 57.895 0.00 0.00 0.00 3.27
747 758 2.760385 GCCCTGGCGTACCTCTCT 60.760 66.667 0.00 0.00 36.63 3.10
801 813 3.515316 CTGTGTCTCCCGTGCCGTT 62.515 63.158 0.00 0.00 0.00 4.44
883 895 3.689347 TGACGGTACAAGAAGGCTAGTA 58.311 45.455 0.00 0.00 0.00 1.82
1008 1022 2.227388 AGCAAGACAAGATTTCGGCTTG 59.773 45.455 0.55 0.55 46.20 4.01
1028 1042 1.343142 GTAGGGCCCAAACAAAACCAG 59.657 52.381 27.56 0.00 0.00 4.00
1082 1096 2.238646 TCCGGAGCAATGGTCAAGTTAT 59.761 45.455 14.70 0.00 0.00 1.89
1295 1310 3.555527 ACATGTCACTAGCTCATGCAT 57.444 42.857 16.82 0.00 41.51 3.96
1566 1584 6.394809 GGTATCATTTTCATTTTTCCGTGGT 58.605 36.000 0.00 0.00 0.00 4.16
1844 1862 6.594788 AATAGAGTTGTTGAATGCACCATT 57.405 33.333 0.00 0.00 36.72 3.16
2271 2290 0.741221 GGACGAGCGGAAGAAAGCAT 60.741 55.000 0.00 0.00 35.48 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.