Multiple sequence alignment - TraesCS2D01G108700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G108700 chr2D 100.000 3197 0 0 1 3197 60199651 60196455 0.000000e+00 5904
1 TraesCS2D01G108700 chr2D 96.449 3013 67 17 1 2995 579083183 579086173 0.000000e+00 4935
2 TraesCS2D01G108700 chr2D 94.853 3031 92 25 1 2995 53764638 53767640 0.000000e+00 4674
3 TraesCS2D01G108700 chr2D 97.684 2029 37 5 1 2027 575952308 575954328 0.000000e+00 3478
4 TraesCS2D01G108700 chr2D 97.596 208 4 1 2990 3197 53767804 53768010 3.920000e-94 355
5 TraesCS2D01G108700 chr2D 97.596 208 4 1 2990 3197 579086340 579086546 3.920000e-94 355
6 TraesCS2D01G108700 chr6D 99.013 3142 27 4 1 3141 97566988 97563850 0.000000e+00 5627
7 TraesCS2D01G108700 chr6D 97.596 208 5 0 2990 3197 469005212 469005005 1.090000e-94 357
8 TraesCS2D01G108700 chr1D 97.804 3005 43 11 1 2995 214087511 214090502 0.000000e+00 5162
9 TraesCS2D01G108700 chr1D 95.995 3021 81 16 1 2995 104468951 104471957 0.000000e+00 4872
10 TraesCS2D01G108700 chr1D 98.028 2028 30 5 1 2027 176896641 176894623 0.000000e+00 3515
11 TraesCS2D01G108700 chr1D 97.596 208 5 0 2990 3197 176893567 176893360 1.090000e-94 357
12 TraesCS2D01G108700 chr3D 97.736 3004 39 10 1 2995 53059199 53056216 0.000000e+00 5144
13 TraesCS2D01G108700 chr3D 97.041 3008 57 9 1 2995 54826215 54823227 0.000000e+00 5033
14 TraesCS2D01G108700 chr3D 94.896 3017 89 19 27 2995 581961965 581964964 0.000000e+00 4658
15 TraesCS2D01G108700 chr3D 98.077 208 4 0 2990 3197 53056046 53055839 2.340000e-96 363
16 TraesCS2D01G108700 chr3D 98.077 208 4 0 2990 3197 54823079 54822872 2.340000e-96 363
17 TraesCS2D01G108700 chr3D 97.596 208 4 1 2990 3197 581965218 581965424 3.920000e-94 355
18 TraesCS2D01G108700 chr7D 94.601 3019 119 20 1 2995 511205734 511208732 0.000000e+00 4632
19 TraesCS2D01G108700 chr7D 94.211 3023 130 26 1 2995 568329619 568332624 0.000000e+00 4571
20 TraesCS2D01G108700 chr6A 94.439 3021 118 23 1 2993 135576273 135579271 0.000000e+00 4602
21 TraesCS2D01G108700 chr6A 98.077 208 4 0 2990 3197 135579551 135579758 2.340000e-96 363


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G108700 chr2D 60196455 60199651 3196 True 5904.0 5904 100.0000 1 3197 1 chr2D.!!$R1 3196
1 TraesCS2D01G108700 chr2D 575952308 575954328 2020 False 3478.0 3478 97.6840 1 2027 1 chr2D.!!$F1 2026
2 TraesCS2D01G108700 chr2D 579083183 579086546 3363 False 2645.0 4935 97.0225 1 3197 2 chr2D.!!$F3 3196
3 TraesCS2D01G108700 chr2D 53764638 53768010 3372 False 2514.5 4674 96.2245 1 3197 2 chr2D.!!$F2 3196
4 TraesCS2D01G108700 chr6D 97563850 97566988 3138 True 5627.0 5627 99.0130 1 3141 1 chr6D.!!$R1 3140
5 TraesCS2D01G108700 chr1D 214087511 214090502 2991 False 5162.0 5162 97.8040 1 2995 1 chr1D.!!$F2 2994
6 TraesCS2D01G108700 chr1D 104468951 104471957 3006 False 4872.0 4872 95.9950 1 2995 1 chr1D.!!$F1 2994
7 TraesCS2D01G108700 chr1D 176893360 176896641 3281 True 1936.0 3515 97.8120 1 3197 2 chr1D.!!$R1 3196
8 TraesCS2D01G108700 chr3D 53055839 53059199 3360 True 2753.5 5144 97.9065 1 3197 2 chr3D.!!$R1 3196
9 TraesCS2D01G108700 chr3D 54822872 54826215 3343 True 2698.0 5033 97.5590 1 3197 2 chr3D.!!$R2 3196
10 TraesCS2D01G108700 chr3D 581961965 581965424 3459 False 2506.5 4658 96.2460 27 3197 2 chr3D.!!$F1 3170
11 TraesCS2D01G108700 chr7D 511205734 511208732 2998 False 4632.0 4632 94.6010 1 2995 1 chr7D.!!$F1 2994
12 TraesCS2D01G108700 chr7D 568329619 568332624 3005 False 4571.0 4571 94.2110 1 2995 1 chr7D.!!$F2 2994
13 TraesCS2D01G108700 chr6A 135576273 135579758 3485 False 2482.5 4602 96.2580 1 3197 2 chr6A.!!$F1 3196

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
159 163 1.233019 GATGCATTCCACGGATGAGG 58.767 55.000 0.0 0.0 0.0 3.86 F
700 724 2.716217 GCCTTTCATCAAGCTAGGTGT 58.284 47.619 0.0 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2116 2178 4.588528 ACTGAAAAGGTTGTATGCCACATT 59.411 37.5 0.0 0.0 36.90 2.71 R
2250 2313 2.554074 GAACGCTACCACCTCGGACC 62.554 65.0 0.0 0.0 38.63 4.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 163 1.233019 GATGCATTCCACGGATGAGG 58.767 55.000 0.00 0.00 0.00 3.86
465 484 4.338795 ACACTAGGAAGAAGAGGATGGA 57.661 45.455 0.00 0.00 0.00 3.41
700 724 2.716217 GCCTTTCATCAAGCTAGGTGT 58.284 47.619 0.00 0.00 0.00 4.16
926 951 4.751600 TCACATTTTTGTTGCAACACACAA 59.248 33.333 31.17 22.29 38.92 3.33
1620 1662 9.552114 CATCATCAAACTAGATCACAAACTTTC 57.448 33.333 0.00 0.00 0.00 2.62
2250 2313 6.853720 TGTTTCTTCGTTAGGTCTAGATCAG 58.146 40.000 5.64 0.00 0.00 2.90
2311 2374 3.719763 CGCGTTCGTATGTAAACTGTTGG 60.720 47.826 0.00 0.00 0.00 3.77
2853 3050 6.603940 TCCTAAAAGCTGCAACCATATTTT 57.396 33.333 1.02 0.64 0.00 1.82
2854 3051 6.397272 TCCTAAAAGCTGCAACCATATTTTG 58.603 36.000 1.02 0.00 0.00 2.44
2855 3052 6.210385 TCCTAAAAGCTGCAACCATATTTTGA 59.790 34.615 1.02 0.00 0.00 2.69
2856 3053 6.873076 CCTAAAAGCTGCAACCATATTTTGAA 59.127 34.615 1.02 0.00 0.00 2.69
2857 3054 7.387397 CCTAAAAGCTGCAACCATATTTTGAAA 59.613 33.333 1.02 0.00 0.00 2.69
2858 3055 7.565323 AAAAGCTGCAACCATATTTTGAAAA 57.435 28.000 1.02 0.00 0.00 2.29
2859 3056 7.565323 AAAGCTGCAACCATATTTTGAAAAA 57.435 28.000 1.02 0.00 0.00 1.94
2860 3057 6.790285 AGCTGCAACCATATTTTGAAAAAG 57.210 33.333 1.02 0.00 0.00 2.27
2861 3058 6.290605 AGCTGCAACCATATTTTGAAAAAGT 58.709 32.000 1.02 0.00 0.00 2.66
2862 3059 6.767423 AGCTGCAACCATATTTTGAAAAAGTT 59.233 30.769 1.02 0.00 0.00 2.66
2863 3060 7.282901 AGCTGCAACCATATTTTGAAAAAGTTT 59.717 29.630 1.02 0.00 0.00 2.66
2864 3061 7.587392 GCTGCAACCATATTTTGAAAAAGTTTC 59.413 33.333 0.00 0.00 0.00 2.78
2865 3062 8.498054 TGCAACCATATTTTGAAAAAGTTTCA 57.502 26.923 0.00 0.00 0.00 2.69
2866 3063 8.950210 TGCAACCATATTTTGAAAAAGTTTCAA 58.050 25.926 11.18 11.18 36.71 2.69
2867 3064 9.220635 GCAACCATATTTTGAAAAAGTTTCAAC 57.779 29.630 14.11 0.00 38.05 3.18
2868 3065 9.715123 CAACCATATTTTGAAAAAGTTTCAACC 57.285 29.630 14.11 0.00 38.05 3.77
2869 3066 9.454859 AACCATATTTTGAAAAAGTTTCAACCA 57.545 25.926 14.11 6.39 38.05 3.67
2870 3067 9.625747 ACCATATTTTGAAAAAGTTTCAACCAT 57.374 25.926 14.11 11.83 38.05 3.55
3080 3599 3.617540 TTTCAAACCACGCATGTAGTG 57.382 42.857 14.01 14.01 39.19 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 163 5.639506 TGACTGTGCTCTTCTTAATTGTAGC 59.360 40.000 0.00 0.00 0.00 3.58
424 443 3.181455 TGTTCTTGTCATGTGTGCTAGGT 60.181 43.478 0.00 0.00 0.00 3.08
912 937 4.662468 ATGGTTATTGTGTGTTGCAACA 57.338 36.364 27.96 27.96 36.38 3.33
2116 2178 4.588528 ACTGAAAAGGTTGTATGCCACATT 59.411 37.500 0.00 0.00 36.90 2.71
2250 2313 2.554074 GAACGCTACCACCTCGGACC 62.554 65.000 0.00 0.00 38.63 4.46
2311 2374 6.047231 GGACACATATGTTTACTGGAGGTAC 58.953 44.000 5.37 0.00 39.95 3.34
2864 3061 9.715123 GGTTGAAACTTTTTCAAAATATGGTTG 57.285 29.630 14.11 0.00 39.76 3.77
2865 3062 9.454859 TGGTTGAAACTTTTTCAAAATATGGTT 57.545 25.926 14.11 0.00 39.76 3.67
2866 3063 9.625747 ATGGTTGAAACTTTTTCAAAATATGGT 57.374 25.926 14.11 0.00 39.76 3.55
2867 3064 9.881529 CATGGTTGAAACTTTTTCAAAATATGG 57.118 29.630 14.11 1.83 39.76 2.74
2872 3069 9.670719 GAAAACATGGTTGAAACTTTTTCAAAA 57.329 25.926 14.11 7.72 39.76 2.44
2873 3070 8.293157 GGAAAACATGGTTGAAACTTTTTCAAA 58.707 29.630 14.11 2.73 39.76 2.69
2874 3071 7.445402 TGGAAAACATGGTTGAAACTTTTTCAA 59.555 29.630 9.50 9.50 36.21 2.69
3080 3599 5.477510 TGTTTTGTGGGATTGCAACATATC 58.522 37.500 0.00 0.00 0.00 1.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.