Multiple sequence alignment - TraesCS2D01G107000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G107000 chr2D 100.000 2852 0 0 1 2852 59450276 59447425 0 5267
1 TraesCS2D01G107000 chr4D 98.237 1872 31 2 1 1872 297889469 297891338 0 3273
2 TraesCS2D01G107000 chr4D 98.673 980 13 0 1873 2852 359857621 359856642 0 1738
3 TraesCS2D01G107000 chr3D 98.130 1872 31 2 1 1872 8677071 8678938 0 3260
4 TraesCS2D01G107000 chr3D 98.980 980 10 0 1873 2852 8678984 8679963 0 1755
5 TraesCS2D01G107000 chr3D 98.673 980 13 0 1873 2852 104201482 104202461 0 1738
6 TraesCS2D01G107000 chr3D 98.469 980 15 0 1873 2852 382995736 382994757 0 1727
7 TraesCS2D01G107000 chr6D 98.131 1873 28 5 1 1873 51478081 51479946 0 3258
8 TraesCS2D01G107000 chr6D 97.811 1873 32 5 1 1873 365439474 365437611 0 3223
9 TraesCS2D01G107000 chr6D 98.776 980 12 0 1873 2852 256718978 256719957 0 1744
10 TraesCS2D01G107000 chr6D 98.673 980 13 0 1873 2852 33275507 33274528 0 1738
11 TraesCS2D01G107000 chr6D 98.571 980 14 0 1873 2852 85192819 85193798 0 1733
12 TraesCS2D01G107000 chr6D 98.571 980 14 0 1873 2852 293100280 293101259 0 1733
13 TraesCS2D01G107000 chr1D 98.077 1872 32 2 1 1872 467310714 467308847 0 3254
14 TraesCS2D01G107000 chr1D 97.811 1873 34 3 1 1873 398922804 398924669 0 3225
15 TraesCS2D01G107000 chr1D 97.756 1872 38 2 1 1872 409801822 409803689 0 3221
16 TraesCS2D01G107000 chr1D 98.571 980 14 0 1873 2852 400133125 400132146 0 1733
17 TraesCS2D01G107000 chr7D 98.024 1872 32 3 1 1872 106887224 106889090 0 3247
18 TraesCS2D01G107000 chr5D 97.811 1873 40 1 1 1873 340330856 340328985 0 3230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G107000 chr2D 59447425 59450276 2851 True 5267.0 5267 100.000 1 2852 1 chr2D.!!$R1 2851
1 TraesCS2D01G107000 chr4D 297889469 297891338 1869 False 3273.0 3273 98.237 1 1872 1 chr4D.!!$F1 1871
2 TraesCS2D01G107000 chr4D 359856642 359857621 979 True 1738.0 1738 98.673 1873 2852 1 chr4D.!!$R1 979
3 TraesCS2D01G107000 chr3D 8677071 8679963 2892 False 2507.5 3260 98.555 1 2852 2 chr3D.!!$F2 2851
4 TraesCS2D01G107000 chr3D 104201482 104202461 979 False 1738.0 1738 98.673 1873 2852 1 chr3D.!!$F1 979
5 TraesCS2D01G107000 chr3D 382994757 382995736 979 True 1727.0 1727 98.469 1873 2852 1 chr3D.!!$R1 979
6 TraesCS2D01G107000 chr6D 51478081 51479946 1865 False 3258.0 3258 98.131 1 1873 1 chr6D.!!$F1 1872
7 TraesCS2D01G107000 chr6D 365437611 365439474 1863 True 3223.0 3223 97.811 1 1873 1 chr6D.!!$R2 1872
8 TraesCS2D01G107000 chr6D 256718978 256719957 979 False 1744.0 1744 98.776 1873 2852 1 chr6D.!!$F3 979
9 TraesCS2D01G107000 chr6D 33274528 33275507 979 True 1738.0 1738 98.673 1873 2852 1 chr6D.!!$R1 979
10 TraesCS2D01G107000 chr6D 85192819 85193798 979 False 1733.0 1733 98.571 1873 2852 1 chr6D.!!$F2 979
11 TraesCS2D01G107000 chr6D 293100280 293101259 979 False 1733.0 1733 98.571 1873 2852 1 chr6D.!!$F4 979
12 TraesCS2D01G107000 chr1D 467308847 467310714 1867 True 3254.0 3254 98.077 1 1872 1 chr1D.!!$R2 1871
13 TraesCS2D01G107000 chr1D 398922804 398924669 1865 False 3225.0 3225 97.811 1 1873 1 chr1D.!!$F1 1872
14 TraesCS2D01G107000 chr1D 409801822 409803689 1867 False 3221.0 3221 97.756 1 1872 1 chr1D.!!$F2 1871
15 TraesCS2D01G107000 chr1D 400132146 400133125 979 True 1733.0 1733 98.571 1873 2852 1 chr1D.!!$R1 979
16 TraesCS2D01G107000 chr7D 106887224 106889090 1866 False 3247.0 3247 98.024 1 1872 1 chr7D.!!$F1 1871
17 TraesCS2D01G107000 chr5D 340328985 340330856 1871 True 3230.0 3230 97.811 1 1873 1 chr5D.!!$R1 1872

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
860 863 2.223829 GCTATGATGAGCGGTACACACT 60.224 50.0 0.0 0.0 31.57 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2324 2372 2.46586 AATGCGTTGTACTGGTGCTA 57.534 45.0 0.0 0.0 0.0 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
387 388 6.098982 TGTTTGTTTGATTTGTGGAACCCTAT 59.901 34.615 0.00 0.0 34.36 2.57
756 759 2.231215 TTTCAAACACAAATGCCCCG 57.769 45.000 0.00 0.0 0.00 5.73
860 863 2.223829 GCTATGATGAGCGGTACACACT 60.224 50.000 0.00 0.0 31.57 3.55
932 935 2.563798 CGCCACCCAACAATGCTGT 61.564 57.895 0.00 0.0 37.39 4.40
965 968 3.144506 CGCTTATTGATCATTGGAGGCT 58.855 45.455 0.00 0.0 0.00 4.58
985 988 2.810274 CTGGAGACACACACTTTCCATG 59.190 50.000 0.00 0.0 37.32 3.66
1058 1061 3.244215 GGTCTTCCTATCGATGGCAATCA 60.244 47.826 8.54 0.0 32.61 2.57
1132 1135 0.822164 CGGTATGGTTCCTCCGAAGT 59.178 55.000 12.22 0.0 44.86 3.01
1286 1289 6.270815 GTGTCTACATGTGGTACGTGATATT 58.729 40.000 9.11 0.0 37.29 1.28
1635 1638 1.891150 ACGACAAAGACGACCCACTAT 59.109 47.619 0.00 0.0 34.70 2.12
1664 1667 1.534729 CTTGGGCTTACAAGTGGGAC 58.465 55.000 7.78 0.0 42.18 4.46
1849 1852 3.222603 GAATGGGAGCCGTATGGAAAAT 58.777 45.455 4.73 0.0 37.49 1.82
2324 2372 2.039879 ACCGTTTTTGATGAGGTAGCCT 59.960 45.455 0.00 0.0 36.03 4.58
2505 2553 4.217836 TCAAGAAAGCAGCTGATGAGAT 57.782 40.909 20.43 0.0 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 1.377229 GAACGAATGGGTGGGGTGA 59.623 57.895 0.00 0.0 0.00 4.02
739 742 1.982660 TACGGGGCATTTGTGTTTGA 58.017 45.000 0.00 0.0 0.00 2.69
860 863 2.116238 GTCCTGCCTCCCTTACATACA 58.884 52.381 0.00 0.0 0.00 2.29
965 968 2.172505 ACATGGAAAGTGTGTGTCTCCA 59.827 45.455 0.00 0.0 40.36 3.86
985 988 2.056223 TCATCTCCCCGGTCCGAAC 61.056 63.158 14.39 0.0 0.00 3.95
1058 1061 8.777413 CATCAGAATCGGTGTTCATACATAAAT 58.223 33.333 0.00 0.0 36.50 1.40
1132 1135 0.541998 TCTGCTTCTGGTTCCCGAGA 60.542 55.000 0.00 0.0 0.00 4.04
1286 1289 3.877559 CCATCAGCAAACATAGTCCTGA 58.122 45.455 0.00 0.0 37.01 3.86
1664 1667 2.587956 TCCGTCGTCTCATTTAACACG 58.412 47.619 0.00 0.0 0.00 4.49
1849 1852 5.570844 GCATAGGGTTACCAAAACTCTCTCA 60.571 44.000 2.98 0.0 40.13 3.27
2324 2372 2.465860 AATGCGTTGTACTGGTGCTA 57.534 45.000 0.00 0.0 0.00 3.49
2505 2553 4.322499 GGGTTGTTTCCAGAATAGTCTCGA 60.322 45.833 0.00 0.0 28.78 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.