Multiple sequence alignment - TraesCS2D01G102900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G102900 chr2D 100.000 1694 0 0 1 1694 55434876 55436569 0.000000e+00 3129.0
1 TraesCS2D01G102900 chr2D 98.073 986 18 1 687 1671 55405326 55406311 0.000000e+00 1714.0
2 TraesCS2D01G102900 chr2D 96.729 1009 31 2 687 1694 55601860 55602867 0.000000e+00 1679.0
3 TraesCS2D01G102900 chr2D 97.246 944 25 1 687 1629 55412944 55413887 0.000000e+00 1598.0
4 TraesCS2D01G102900 chr2D 92.758 1008 70 3 687 1693 39438080 39437075 0.000000e+00 1454.0
5 TraesCS2D01G102900 chr2D 99.125 686 6 0 1 686 55423062 55423747 0.000000e+00 1234.0
6 TraesCS2D01G102900 chr2D 96.398 694 24 1 1 694 231072793 231072101 0.000000e+00 1142.0
7 TraesCS2D01G102900 chr2D 100.000 529 0 0 2039 2567 55436914 55437442 0.000000e+00 977.0
8 TraesCS2D01G102900 chr2D 94.350 531 28 1 2039 2567 55602935 55603465 0.000000e+00 813.0
9 TraesCS2D01G102900 chr2D 92.655 531 34 3 2039 2567 55414170 55414697 0.000000e+00 760.0
10 TraesCS2D01G102900 chr2D 92.467 531 33 5 2039 2567 55406535 55407060 0.000000e+00 752.0
11 TraesCS2D01G102900 chr7D 97.230 686 19 0 1 686 463616749 463616064 0.000000e+00 1162.0
12 TraesCS2D01G102900 chr7D 96.939 686 20 1 2 686 266794175 266793490 0.000000e+00 1149.0
13 TraesCS2D01G102900 chr5D 96.821 692 20 2 1 690 72436305 72436996 0.000000e+00 1155.0
14 TraesCS2D01G102900 chr5D 96.522 690 24 0 1 690 307952403 307953092 0.000000e+00 1142.0
15 TraesCS2D01G102900 chr6D 96.798 687 20 2 1 686 429545749 429546434 0.000000e+00 1146.0
16 TraesCS2D01G102900 chr1D 96.798 687 21 1 1 686 146977414 146978100 0.000000e+00 1146.0
17 TraesCS2D01G102900 chr1D 96.532 692 21 3 1 691 352447656 352446967 0.000000e+00 1142.0
18 TraesCS2D01G102900 chr2B 95.701 535 21 2 687 1220 88187972 88188505 0.000000e+00 859.0
19 TraesCS2D01G102900 chr2B 90.213 235 23 0 1367 1601 88241317 88241551 8.920000e-80 307.0
20 TraesCS2D01G102900 chr2B 90.741 108 9 1 1577 1684 88231610 88231716 2.660000e-30 143.0
21 TraesCS2D01G102900 chr2B 89.815 108 10 1 1577 1684 88241558 88241664 1.240000e-28 137.0
22 TraesCS2D01G102900 chr2A 87.269 542 26 13 687 1228 56945238 56945736 1.710000e-161 579.0
23 TraesCS2D01G102900 chr2A 88.333 360 42 0 1226 1585 56990606 56990965 1.410000e-117 433.0
24 TraesCS2D01G102900 chr7B 75.969 258 51 6 2256 2505 392641913 392641659 3.470000e-24 122.0
25 TraesCS2D01G102900 chr3B 85.714 56 8 0 2256 2311 439344180 439344235 2.760000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G102900 chr2D 55434876 55437442 2566 False 2053 3129 100.0000 1 2567 2 chr2D.!!$F4 2566
1 TraesCS2D01G102900 chr2D 39437075 39438080 1005 True 1454 1454 92.7580 687 1693 1 chr2D.!!$R1 1006
2 TraesCS2D01G102900 chr2D 55601860 55603465 1605 False 1246 1679 95.5395 687 2567 2 chr2D.!!$F5 1880
3 TraesCS2D01G102900 chr2D 55423062 55423747 685 False 1234 1234 99.1250 1 686 1 chr2D.!!$F1 685
4 TraesCS2D01G102900 chr2D 55405326 55407060 1734 False 1233 1714 95.2700 687 2567 2 chr2D.!!$F2 1880
5 TraesCS2D01G102900 chr2D 55412944 55414697 1753 False 1179 1598 94.9505 687 2567 2 chr2D.!!$F3 1880
6 TraesCS2D01G102900 chr2D 231072101 231072793 692 True 1142 1142 96.3980 1 694 1 chr2D.!!$R2 693
7 TraesCS2D01G102900 chr7D 463616064 463616749 685 True 1162 1162 97.2300 1 686 1 chr7D.!!$R2 685
8 TraesCS2D01G102900 chr7D 266793490 266794175 685 True 1149 1149 96.9390 2 686 1 chr7D.!!$R1 684
9 TraesCS2D01G102900 chr5D 72436305 72436996 691 False 1155 1155 96.8210 1 690 1 chr5D.!!$F1 689
10 TraesCS2D01G102900 chr5D 307952403 307953092 689 False 1142 1142 96.5220 1 690 1 chr5D.!!$F2 689
11 TraesCS2D01G102900 chr6D 429545749 429546434 685 False 1146 1146 96.7980 1 686 1 chr6D.!!$F1 685
12 TraesCS2D01G102900 chr1D 146977414 146978100 686 False 1146 1146 96.7980 1 686 1 chr1D.!!$F1 685
13 TraesCS2D01G102900 chr1D 352446967 352447656 689 True 1142 1142 96.5320 1 691 1 chr1D.!!$R1 690
14 TraesCS2D01G102900 chr2B 88187972 88188505 533 False 859 859 95.7010 687 1220 1 chr2B.!!$F1 533

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
966 973 3.689161 TCTACATGGCCACAAAGATTTCG 59.311 43.478 8.16 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2323 2330 0.916086 ATACAACCGCCTTGGATGGA 59.084 50.0 5.56 0.0 44.51 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
811 817 9.569167 CGGATATACATCACATAAAAGATACGT 57.431 33.333 0.00 0.00 32.32 3.57
966 973 3.689161 TCTACATGGCCACAAAGATTTCG 59.311 43.478 8.16 0.00 0.00 3.46
1498 1505 5.473846 TCGCCATTGTACAAGATGGTTTTAA 59.526 36.000 23.07 7.62 43.77 1.52
2452 2462 0.905357 ATGCCCGCTTCTGACTAACT 59.095 50.000 0.00 0.00 0.00 2.24
2473 2483 0.040499 GGCCCACCCAAACCATTCTA 59.960 55.000 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
289 292 1.381928 GGATCGCACGGGACTGACTA 61.382 60.000 0.00 0.0 0.00 2.59
966 973 6.402983 CCTGTGTCTTTCTCTATGTGAAATGC 60.403 42.308 0.00 0.0 33.65 3.56
1230 1237 5.067273 TGGGTTTCTTGACACGAATATTGT 58.933 37.500 0.00 0.0 0.00 2.71
1498 1505 1.305297 TGCTCAGATCCCGGTCAGT 60.305 57.895 0.00 0.0 0.00 3.41
2052 2059 7.373778 CACATCATGTGGAATGGATATAGTG 57.626 40.000 10.22 0.0 44.27 2.74
2323 2330 0.916086 ATACAACCGCCTTGGATGGA 59.084 50.000 5.56 0.0 44.51 3.41
2452 2462 1.074167 AATGGTTTGGGTGGGCCAA 60.074 52.632 8.40 0.0 34.39 4.52
2473 2483 4.344865 AAAGGGTGCGGGCGACAT 62.345 61.111 0.00 0.0 0.00 3.06
2512 2522 1.070758 GTTCAAGTCTGGCACTGGAGA 59.929 52.381 0.00 0.0 36.33 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.