Multiple sequence alignment - TraesCS2D01G101600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G101600 chr2D 100.000 2493 0 0 1 2493 54792981 54790489 0 4604
1 TraesCS2D01G101600 chr1D 98.878 2495 24 4 1 2493 143269200 143266708 0 4449
2 TraesCS2D01G101600 chr1D 98.402 2503 27 6 1 2493 203582848 203585347 0 4388
3 TraesCS2D01G101600 chr1D 98.162 2503 29 7 1 2493 19993794 19991299 0 4351
4 TraesCS2D01G101600 chr5D 98.442 2503 26 6 1 2493 335823507 335826006 0 4394
5 TraesCS2D01G101600 chr5D 98.363 2505 23 12 1 2493 55023998 55021500 0 4383
6 TraesCS2D01G101600 chr3D 98.442 2503 25 5 1 2493 68827263 68824765 0 4394
7 TraesCS2D01G101600 chr3D 97.200 893 12 5 1 882 414811280 414810390 0 1498
8 TraesCS2D01G101600 chr7D 98.363 2504 24 8 1 2493 567321998 567324495 0 4381
9 TraesCS2D01G101600 chr7D 98.244 2505 29 6 1 2493 589613511 589611010 0 4368
10 TraesCS2D01G101600 chr7D 98.932 2434 21 5 1 2431 403463713 403466144 0 4346
11 TraesCS2D01G101600 chr6D 98.162 2503 33 7 1 2493 42264550 42262051 0 4355
12 TraesCS2D01G101600 chr6D 98.075 2494 35 8 1 2493 5280197 5277716 0 4327
13 TraesCS2D01G101600 chr4D 98.162 2503 31 7 1 2493 433308257 433305760 0 4353
14 TraesCS2D01G101600 chr4D 98.084 2505 32 7 1 2493 502304550 502307050 0 4346


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G101600 chr2D 54790489 54792981 2492 True 4604 4604 100.000 1 2493 1 chr2D.!!$R1 2492
1 TraesCS2D01G101600 chr1D 143266708 143269200 2492 True 4449 4449 98.878 1 2493 1 chr1D.!!$R2 2492
2 TraesCS2D01G101600 chr1D 203582848 203585347 2499 False 4388 4388 98.402 1 2493 1 chr1D.!!$F1 2492
3 TraesCS2D01G101600 chr1D 19991299 19993794 2495 True 4351 4351 98.162 1 2493 1 chr1D.!!$R1 2492
4 TraesCS2D01G101600 chr5D 335823507 335826006 2499 False 4394 4394 98.442 1 2493 1 chr5D.!!$F1 2492
5 TraesCS2D01G101600 chr5D 55021500 55023998 2498 True 4383 4383 98.363 1 2493 1 chr5D.!!$R1 2492
6 TraesCS2D01G101600 chr3D 68824765 68827263 2498 True 4394 4394 98.442 1 2493 1 chr3D.!!$R1 2492
7 TraesCS2D01G101600 chr3D 414810390 414811280 890 True 1498 1498 97.200 1 882 1 chr3D.!!$R2 881
8 TraesCS2D01G101600 chr7D 567321998 567324495 2497 False 4381 4381 98.363 1 2493 1 chr7D.!!$F2 2492
9 TraesCS2D01G101600 chr7D 589611010 589613511 2501 True 4368 4368 98.244 1 2493 1 chr7D.!!$R1 2492
10 TraesCS2D01G101600 chr7D 403463713 403466144 2431 False 4346 4346 98.932 1 2431 1 chr7D.!!$F1 2430
11 TraesCS2D01G101600 chr6D 42262051 42264550 2499 True 4355 4355 98.162 1 2493 1 chr6D.!!$R2 2492
12 TraesCS2D01G101600 chr6D 5277716 5280197 2481 True 4327 4327 98.075 1 2493 1 chr6D.!!$R1 2492
13 TraesCS2D01G101600 chr4D 433305760 433308257 2497 True 4353 4353 98.162 1 2493 1 chr4D.!!$R1 2492
14 TraesCS2D01G101600 chr4D 502304550 502307050 2500 False 4346 4346 98.084 1 2493 1 chr4D.!!$F1 2492

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
537 594 0.591741 CTAGCGTCGAATGTCCGTCC 60.592 60.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1757 1815 2.352225 GCAAGTGCGAGAGAGAAGAGAA 60.352 50.0 0.0 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 255 9.747898 TGAAAATGACCTACACCAAGTTTATAT 57.252 29.630 0.00 0.00 0.00 0.86
366 419 7.983166 AATGCCCCTATACCGAGTTTATATA 57.017 36.000 0.00 0.00 0.00 0.86
529 586 0.899720 TCCAAACCCTAGCGTCGAAT 59.100 50.000 0.00 0.00 0.00 3.34
537 594 0.591741 CTAGCGTCGAATGTCCGTCC 60.592 60.000 0.00 0.00 0.00 4.79
1559 1617 8.097038 AGTCTGTTTATCTCAAATGCAACTCTA 58.903 33.333 0.00 0.00 0.00 2.43
1620 1678 6.730960 ACTGTTAAGTTTCGACACTTTCAA 57.269 33.333 21.08 8.67 38.07 2.69
1757 1815 6.058183 GCACAAGGGATATACATCAAGTTCT 58.942 40.000 0.00 0.00 32.32 3.01
2110 2174 1.133294 TGGAAAAAGAGGTCCAACCCC 60.133 52.381 0.00 0.00 41.02 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 9.534565 CATTTTCGAGTGAATAAGAAGGATCTA 57.465 33.333 0.00 0.00 32.37 1.98
504 561 1.017387 CGCTAGGGTTTGGAGCATTC 58.983 55.000 0.00 0.00 35.91 2.67
537 594 1.300233 GCGCTTGGTAGGATCCGAG 60.300 63.158 5.98 2.19 40.86 4.63
1047 1105 5.045578 CCCATTCTTCTCCTCCTTCAAAGTA 60.046 44.000 0.00 0.00 0.00 2.24
1559 1617 4.867047 CAGAGATCGACAGTTGCACTAAAT 59.133 41.667 0.00 0.00 0.00 1.40
1620 1678 3.244422 TGGTACTTGTCTTCTGCCGAAAT 60.244 43.478 0.00 0.00 0.00 2.17
1757 1815 2.352225 GCAAGTGCGAGAGAGAAGAGAA 60.352 50.000 0.00 0.00 0.00 2.87
1998 2060 3.169908 GGGACCCATAAAGGAAAGCAAA 58.830 45.455 5.33 0.00 41.22 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.