Multiple sequence alignment - TraesCS2D01G098600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G098600 chr2D 100.000 4802 0 0 1 4802 50733487 50738288 0 8868
1 TraesCS2D01G098600 chr2D 96.720 3872 96 20 958 4802 74762004 74758137 0 6418
2 TraesCS2D01G098600 chr2D 97.298 2961 60 3 1848 4802 174562942 174565888 0 5007
3 TraesCS2D01G098600 chr5D 98.106 4805 86 4 1 4802 532816748 532811946 0 8364
4 TraesCS2D01G098600 chr6D 98.654 4309 54 3 1 4306 444645920 444641613 0 7633
5 TraesCS2D01G098600 chr6D 97.944 4182 81 2 622 4802 215533621 215537798 0 7241
6 TraesCS2D01G098600 chr6D 98.854 4015 45 1 1 4014 426834308 426830294 0 7158
7 TraesCS2D01G098600 chr6D 97.904 4103 77 4 704 4802 438955905 438960002 0 7092
8 TraesCS2D01G098600 chr4D 97.920 4183 81 3 622 4802 499513333 499517511 0 7238
9 TraesCS2D01G098600 chr7D 98.602 4078 52 5 1 4077 18977768 18973695 0 7210
10 TraesCS2D01G098600 chr7D 98.016 857 16 1 1 856 86374565 86375421 0 1487
11 TraesCS2D01G098600 chr7D 98.012 855 16 1 1 854 515844535 515843681 0 1483
12 TraesCS2D01G098600 chr7D 96.491 855 13 5 1 854 254130886 254131724 0 1397
13 TraesCS2D01G098600 chr1D 98.308 4078 65 4 1 4077 240731845 240735919 0 7145
14 TraesCS2D01G098600 chr1D 98.363 855 12 2 1 854 10455035 10454182 0 1500
15 TraesCS2D01G098600 chr3D 98.167 4092 70 2 712 4802 422019784 422015697 0 7136
16 TraesCS2D01G098600 chr3D 96.761 988 26 2 3816 4802 301322394 301321412 0 1642
17 TraesCS2D01G098600 chr3D 97.277 955 24 2 3849 4802 43601207 43602160 0 1618
18 TraesCS2D01G098600 chr3D 96.356 988 29 3 3816 4802 555020557 555021538 0 1618
19 TraesCS2D01G098600 chr3D 96.255 988 31 2 3816 4802 500116308 500115326 0 1615


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G098600 chr2D 50733487 50738288 4801 False 8868 8868 100.000 1 4802 1 chr2D.!!$F1 4801
1 TraesCS2D01G098600 chr2D 74758137 74762004 3867 True 6418 6418 96.720 958 4802 1 chr2D.!!$R1 3844
2 TraesCS2D01G098600 chr2D 174562942 174565888 2946 False 5007 5007 97.298 1848 4802 1 chr2D.!!$F2 2954
3 TraesCS2D01G098600 chr5D 532811946 532816748 4802 True 8364 8364 98.106 1 4802 1 chr5D.!!$R1 4801
4 TraesCS2D01G098600 chr6D 444641613 444645920 4307 True 7633 7633 98.654 1 4306 1 chr6D.!!$R2 4305
5 TraesCS2D01G098600 chr6D 215533621 215537798 4177 False 7241 7241 97.944 622 4802 1 chr6D.!!$F1 4180
6 TraesCS2D01G098600 chr6D 426830294 426834308 4014 True 7158 7158 98.854 1 4014 1 chr6D.!!$R1 4013
7 TraesCS2D01G098600 chr6D 438955905 438960002 4097 False 7092 7092 97.904 704 4802 1 chr6D.!!$F2 4098
8 TraesCS2D01G098600 chr4D 499513333 499517511 4178 False 7238 7238 97.920 622 4802 1 chr4D.!!$F1 4180
9 TraesCS2D01G098600 chr7D 18973695 18977768 4073 True 7210 7210 98.602 1 4077 1 chr7D.!!$R1 4076
10 TraesCS2D01G098600 chr7D 86374565 86375421 856 False 1487 1487 98.016 1 856 1 chr7D.!!$F1 855
11 TraesCS2D01G098600 chr7D 515843681 515844535 854 True 1483 1483 98.012 1 854 1 chr7D.!!$R2 853
12 TraesCS2D01G098600 chr7D 254130886 254131724 838 False 1397 1397 96.491 1 854 1 chr7D.!!$F2 853
13 TraesCS2D01G098600 chr1D 240731845 240735919 4074 False 7145 7145 98.308 1 4077 1 chr1D.!!$F1 4076
14 TraesCS2D01G098600 chr1D 10454182 10455035 853 True 1500 1500 98.363 1 854 1 chr1D.!!$R1 853
15 TraesCS2D01G098600 chr3D 422015697 422019784 4087 True 7136 7136 98.167 712 4802 1 chr3D.!!$R2 4090
16 TraesCS2D01G098600 chr3D 301321412 301322394 982 True 1642 1642 96.761 3816 4802 1 chr3D.!!$R1 986
17 TraesCS2D01G098600 chr3D 43601207 43602160 953 False 1618 1618 97.277 3849 4802 1 chr3D.!!$F1 953
18 TraesCS2D01G098600 chr3D 555020557 555021538 981 False 1618 1618 96.356 3816 4802 1 chr3D.!!$F2 986
19 TraesCS2D01G098600 chr3D 500115326 500116308 982 True 1615 1615 96.255 3816 4802 1 chr3D.!!$R3 986

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1120 1132 0.030638 AATCAGCGCACCACAAACAC 59.969 50.000 11.47 0.0 0.00 3.32 F
1878 1890 1.160137 GCAAGAACGCAGATTGTCCT 58.840 50.000 0.00 0.0 0.00 3.85 F
3156 3169 1.061711 CGTCAAATAGCAGAGCAGCAC 59.938 52.381 0.00 0.0 36.85 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2618 2631 1.731433 GAGATGGCGCATGCACCAAT 61.731 55.000 29.88 21.33 45.35 3.16 R
3744 3757 1.005228 TACCTCCTCTTCTTCCCCGA 58.995 55.000 0.00 0.00 0.00 5.14 R
4356 4554 2.733593 GCGACGCGTTTCTCACCT 60.734 61.111 15.53 0.00 0.00 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1120 1132 0.030638 AATCAGCGCACCACAAACAC 59.969 50.000 11.47 0.00 0.00 3.32
1148 1160 6.706270 TCTGTTAGTCAGTTGAAAGAATGGAC 59.294 38.462 0.00 0.00 43.97 4.02
1806 1818 6.805016 ATAATTAATTGGGCAATGTCCACA 57.195 33.333 5.86 0.00 36.87 4.17
1878 1890 1.160137 GCAAGAACGCAGATTGTCCT 58.840 50.000 0.00 0.00 0.00 3.85
1991 2004 5.508567 TCAAGATCATGCCAACCTTTCATA 58.491 37.500 0.00 0.00 0.00 2.15
2203 2216 3.170672 TCCACACCCTGCAGCAGT 61.171 61.111 21.26 4.84 0.00 4.40
3017 3030 1.078426 ATGGAGCAAGGTACGGTGC 60.078 57.895 10.57 10.57 43.04 5.01
3090 3103 1.205417 GCATTGCCACTTACAGCCATT 59.795 47.619 0.00 0.00 0.00 3.16
3115 3128 3.525609 TGAGGGTATTTTCTATGGCACCA 59.474 43.478 0.00 0.00 0.00 4.17
3156 3169 1.061711 CGTCAAATAGCAGAGCAGCAC 59.938 52.381 0.00 0.00 36.85 4.40
3178 3191 6.690530 CACATCTTGAACAACCCAAATACAT 58.309 36.000 0.00 0.00 0.00 2.29
3460 3473 1.129624 TGGACGCAATATCGTTTGTGC 59.870 47.619 8.30 0.00 43.42 4.57
3744 3757 4.778143 GGGCGTGGACGAGGCAAT 62.778 66.667 2.73 0.00 43.02 3.56
4199 4397 4.327680 CACTCCTAAGGAAAACTGGAAGG 58.672 47.826 0.00 0.00 39.30 3.46
4331 4529 2.050350 GGGCCGGCCTTTTACCTTC 61.050 63.158 42.70 20.78 36.10 3.46
4356 4554 2.100197 CGTCTGGTTGAGTCTATCCCA 58.900 52.381 0.00 0.00 0.00 4.37
4369 4567 0.174845 TATCCCAGGTGAGAAACGCG 59.825 55.000 3.53 3.53 0.00 6.01
4495 4693 3.244078 TGTGTCACTTTTGCTCGGACTAT 60.244 43.478 4.27 0.00 0.00 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 7.920151 ACACAAATATTTACGTATACTACCGCA 59.080 33.333 0.00 0.00 0.00 5.69
151 152 4.134187 CGAAGCGTGCGTGCGAAT 62.134 61.111 5.04 0.00 40.67 3.34
493 497 1.067425 CATCGGGTACGGACTGAAACA 60.067 52.381 0.00 0.00 41.40 2.83
602 606 1.226030 AAACTACAGCGTGGCCGTTC 61.226 55.000 0.00 0.00 36.15 3.95
1148 1160 1.197721 CAAGACCTAAACTTGCCGCAG 59.802 52.381 0.00 0.00 38.28 5.18
1310 1322 1.739067 GACGGGAAGCACTAAAGCAT 58.261 50.000 0.00 0.00 36.85 3.79
1806 1818 3.132824 CCTCAGCTTTGAAAACCCTTTGT 59.867 43.478 0.00 0.00 0.00 2.83
2203 2216 2.567169 CGATATAGGTGCCTGGATTCCA 59.433 50.000 5.05 5.05 0.00 3.53
2618 2631 1.731433 GAGATGGCGCATGCACCAAT 61.731 55.000 29.88 21.33 45.35 3.16
3017 3030 1.787847 GCGAGGTTCGTTGTCATGG 59.212 57.895 0.00 0.00 42.81 3.66
3090 3103 4.947388 GTGCCATAGAAAATACCCTCAACA 59.053 41.667 0.00 0.00 0.00 3.33
3115 3128 6.071896 TGACGTCTGTCTCTGAAATACTTGAT 60.072 38.462 17.92 0.00 45.70 2.57
3156 3169 6.101332 CCATGTATTTGGGTTGTTCAAGATG 58.899 40.000 0.00 0.00 32.80 2.90
3460 3473 5.298777 CAGCCTCTTTCAGAAAATATGGAGG 59.701 44.000 18.01 18.01 36.71 4.30
3744 3757 1.005228 TACCTCCTCTTCTTCCCCGA 58.995 55.000 0.00 0.00 0.00 5.14
4199 4397 3.462021 GCTGAATCCATCCTGAGTGTAC 58.538 50.000 0.00 0.00 0.00 2.90
4356 4554 2.733593 GCGACGCGTTTCTCACCT 60.734 61.111 15.53 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.