Multiple sequence alignment - TraesCS2D01G090100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G090100 chr2D 100.000 2261 0 0 1 2261 39831942 39829682 0.000000e+00 4176.0
1 TraesCS2D01G090100 chr2D 92.814 1336 75 7 1 1327 55315509 55316832 0.000000e+00 1916.0
2 TraesCS2D01G090100 chr2D 87.944 647 63 11 624 1268 55357307 55356674 0.000000e+00 749.0
3 TraesCS2D01G090100 chr2D 86.667 660 39 22 1621 2261 55369405 55370034 0.000000e+00 686.0
4 TraesCS2D01G090100 chr2D 88.235 408 42 3 186 593 55357766 55357365 1.210000e-132 483.0
5 TraesCS2D01G090100 chr2D 97.143 70 2 0 125 194 55359010 55358941 3.950000e-23 119.0
6 TraesCS2D01G090100 chr2A 94.341 1396 69 8 1 1388 56916791 56918184 0.000000e+00 2132.0
7 TraesCS2D01G090100 chr2A 92.429 885 22 8 1392 2261 56918270 56919124 0.000000e+00 1221.0
8 TraesCS2D01G090100 chr2A 78.016 514 96 16 1 508 619209261 619209763 7.840000e-80 307.0
9 TraesCS2D01G090100 chr2A 71.837 490 120 16 766 1251 115786852 115786377 8.480000e-25 124.0
10 TraesCS2D01G090100 chr2B 95.045 888 22 6 1393 2261 87842856 87843740 0.000000e+00 1376.0
11 TraesCS2D01G090100 chr2B 89.189 777 54 17 624 1390 87842041 87842797 0.000000e+00 942.0
12 TraesCS2D01G090100 chr2B 92.892 619 37 3 1 618 87841390 87842002 0.000000e+00 893.0
13 TraesCS2D01G090100 chr2B 88.889 54 6 0 384 437 24906277 24906330 1.450000e-07 67.6
14 TraesCS2D01G090100 chr7D 89.554 785 75 4 1477 2261 559667802 559668579 0.000000e+00 989.0
15 TraesCS2D01G090100 chr7B 88.946 778 67 11 1477 2252 620580304 620579544 0.000000e+00 942.0
16 TraesCS2D01G090100 chr7B 90.323 93 4 2 1390 1479 620580427 620580337 1.420000e-22 117.0
17 TraesCS2D01G090100 chr4A 87.389 785 85 8 1477 2261 520190045 520189275 0.000000e+00 889.0
18 TraesCS2D01G090100 chr4A 83.008 512 78 8 757 1265 529634142 529633637 2.650000e-124 455.0
19 TraesCS2D01G090100 chr4A 90.323 93 6 1 1390 1479 520190170 520190078 3.950000e-23 119.0
20 TraesCS2D01G090100 chr4D 87.404 778 68 16 1477 2252 191271023 191270274 0.000000e+00 867.0
21 TraesCS2D01G090100 chr4D 87.801 582 62 7 1 577 65860611 65861188 0.000000e+00 673.0
22 TraesCS2D01G090100 chr4D 81.569 510 85 8 747 1253 65861380 65861883 1.620000e-111 412.0
23 TraesCS2D01G090100 chr4D 93.548 93 3 1 1390 1479 191271148 191271056 3.920000e-28 135.0
24 TraesCS2D01G090100 chr4B 88.966 580 59 5 1 577 96630621 96631198 0.000000e+00 712.0
25 TraesCS2D01G090100 chr4B 82.218 523 80 12 736 1253 96631418 96631932 2.670000e-119 438.0
26 TraesCS2D01G090100 chr5B 74.009 454 82 29 1 440 508344131 508343700 3.890000e-33 152.0
27 TraesCS2D01G090100 chr5B 73.121 439 88 26 13 440 508351763 508351344 1.820000e-26 130.0
28 TraesCS2D01G090100 chr5B 78.571 126 21 5 299 421 489821409 489821531 6.700000e-11 78.7
29 TraesCS2D01G090100 chr5D 73.786 309 63 15 13 316 421887115 421886820 3.070000e-19 106.0
30 TraesCS2D01G090100 chr5A 90.476 63 4 2 360 421 514160617 514160678 5.180000e-12 82.4
31 TraesCS2D01G090100 chr3B 91.304 46 4 0 1042 1087 799449240 799449285 1.870000e-06 63.9
32 TraesCS2D01G090100 chr3B 89.130 46 3 2 772 816 111673895 111673851 3.140000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G090100 chr2D 39829682 39831942 2260 True 4176.000000 4176 100.000000 1 2261 1 chr2D.!!$R1 2260
1 TraesCS2D01G090100 chr2D 55315509 55316832 1323 False 1916.000000 1916 92.814000 1 1327 1 chr2D.!!$F1 1326
2 TraesCS2D01G090100 chr2D 55369405 55370034 629 False 686.000000 686 86.667000 1621 2261 1 chr2D.!!$F2 640
3 TraesCS2D01G090100 chr2D 55356674 55359010 2336 True 450.333333 749 91.107333 125 1268 3 chr2D.!!$R2 1143
4 TraesCS2D01G090100 chr2A 56916791 56919124 2333 False 1676.500000 2132 93.385000 1 2261 2 chr2A.!!$F2 2260
5 TraesCS2D01G090100 chr2A 619209261 619209763 502 False 307.000000 307 78.016000 1 508 1 chr2A.!!$F1 507
6 TraesCS2D01G090100 chr2B 87841390 87843740 2350 False 1070.333333 1376 92.375333 1 2261 3 chr2B.!!$F2 2260
7 TraesCS2D01G090100 chr7D 559667802 559668579 777 False 989.000000 989 89.554000 1477 2261 1 chr7D.!!$F1 784
8 TraesCS2D01G090100 chr7B 620579544 620580427 883 True 529.500000 942 89.634500 1390 2252 2 chr7B.!!$R1 862
9 TraesCS2D01G090100 chr4A 520189275 520190170 895 True 504.000000 889 88.856000 1390 2261 2 chr4A.!!$R2 871
10 TraesCS2D01G090100 chr4A 529633637 529634142 505 True 455.000000 455 83.008000 757 1265 1 chr4A.!!$R1 508
11 TraesCS2D01G090100 chr4D 65860611 65861883 1272 False 542.500000 673 84.685000 1 1253 2 chr4D.!!$F1 1252
12 TraesCS2D01G090100 chr4D 191270274 191271148 874 True 501.000000 867 90.476000 1390 2252 2 chr4D.!!$R1 862
13 TraesCS2D01G090100 chr4B 96630621 96631932 1311 False 575.000000 712 85.592000 1 1253 2 chr4B.!!$F1 1252

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
899 2232 0.249155 GTGGACGTCGGTGAGTTCAA 60.249 55.0 9.92 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1998 3514 2.095372 GCCTCCACCTTAAAATTCGTCG 59.905 50.0 0.0 0.0 0.0 5.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
421 1606 0.779997 ACTTCAAGGGCAAGTGGGAT 59.220 50.000 0.00 0.00 32.65 3.85
509 1694 1.676635 GTGCCCTTCATGCAGAGCA 60.677 57.895 0.00 0.00 44.86 4.26
610 1795 2.106683 GTGCCCTCCGTTTCATCCG 61.107 63.158 0.00 0.00 0.00 4.18
898 2231 1.361271 GTGGACGTCGGTGAGTTCA 59.639 57.895 9.92 0.00 0.00 3.18
899 2232 0.249155 GTGGACGTCGGTGAGTTCAA 60.249 55.000 9.92 0.00 0.00 2.69
1038 2372 3.483869 GGCCTCCCGCTGATCCTT 61.484 66.667 0.00 0.00 37.74 3.36
1055 2389 0.456221 CTTAGCGAGGTCGTCCACAT 59.544 55.000 0.51 0.00 42.22 3.21
1112 2455 4.722700 GGCCGCCACCATGTGTCT 62.723 66.667 3.91 0.00 0.00 3.41
1113 2456 2.672996 GCCGCCACCATGTGTCTT 60.673 61.111 0.00 0.00 0.00 3.01
1114 2457 1.376683 GCCGCCACCATGTGTCTTA 60.377 57.895 0.00 0.00 0.00 2.10
1115 2458 0.748005 GCCGCCACCATGTGTCTTAT 60.748 55.000 0.00 0.00 0.00 1.73
1116 2459 1.016627 CCGCCACCATGTGTCTTATG 58.983 55.000 0.00 0.00 0.00 1.90
1171 2517 0.476771 ACCGGTGGTGGATTTTGTCT 59.523 50.000 6.12 0.00 32.98 3.41
1294 2648 4.642885 GGATGTTGGAATTCCCGTATTTCA 59.357 41.667 21.90 10.08 37.93 2.69
1328 2688 5.895636 TGCGTTTGAAATAGATGACCAAT 57.104 34.783 0.00 0.00 0.00 3.16
1329 2689 6.266168 TGCGTTTGAAATAGATGACCAATT 57.734 33.333 0.00 0.00 0.00 2.32
1388 2749 4.579869 TGTTCCTTCAGGCTTAGTTGATC 58.420 43.478 0.00 0.00 34.44 2.92
1543 3030 3.684788 ACCACTCACGATAACAAATGAGC 59.315 43.478 0.00 0.00 41.93 4.26
1998 3514 0.539051 ACAGGCATCCAGTAGACAGC 59.461 55.000 0.00 0.00 0.00 4.40
2003 3519 0.733150 CATCCAGTAGACAGCGACGA 59.267 55.000 0.00 0.00 0.00 4.20
2043 3559 2.020720 TGGATGTCGCAAACTGTTGTT 58.979 42.857 0.00 0.00 37.06 2.83
2128 3646 5.202004 GAGTGAGAAACCTCCTCCAGTATA 58.798 45.833 0.00 0.00 0.00 1.47
2187 3707 5.247507 TCATATTGCCATTGTAGTGCAAC 57.752 39.130 0.00 0.00 46.60 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
509 1694 1.674057 CCACGAACTGCCTCTTCCT 59.326 57.895 0.00 0.00 0.00 3.36
538 1723 1.527433 GCTTGAGCACCTTGAACCCC 61.527 60.000 0.00 0.00 41.59 4.95
593 1778 2.238847 CTCGGATGAAACGGAGGGCA 62.239 60.000 0.00 0.00 34.89 5.36
598 1783 0.450583 CGTCTCTCGGATGAAACGGA 59.549 55.000 0.00 0.00 35.71 4.69
728 2013 1.346395 TGTAGCTGTCGTTGGAATGGT 59.654 47.619 0.00 0.00 0.00 3.55
845 2178 3.502572 GCTCGTGCAAGAATCCCC 58.497 61.111 3.39 0.00 39.41 4.81
871 2204 2.022129 CGACGTCCACCTTGTGAGC 61.022 63.158 10.58 0.00 35.23 4.26
876 2209 1.372997 CTCACCGACGTCCACCTTG 60.373 63.158 10.58 0.20 0.00 3.61
1038 2372 1.306148 CTATGTGGACGACCTCGCTA 58.694 55.000 5.33 0.00 44.43 4.26
1055 2389 0.454600 GTTCACCTCGATGACCGCTA 59.545 55.000 0.00 0.00 38.37 4.26
1100 2434 2.923121 CCTCCATAAGACACATGGTGG 58.077 52.381 7.78 7.78 45.73 4.61
1109 2452 0.470341 GCACCCCTCCTCCATAAGAC 59.530 60.000 0.00 0.00 0.00 3.01
1110 2453 1.048724 CGCACCCCTCCTCCATAAGA 61.049 60.000 0.00 0.00 0.00 2.10
1111 2454 1.447643 CGCACCCCTCCTCCATAAG 59.552 63.158 0.00 0.00 0.00 1.73
1112 2455 2.742116 GCGCACCCCTCCTCCATAA 61.742 63.158 0.30 0.00 0.00 1.90
1113 2456 3.161450 GCGCACCCCTCCTCCATA 61.161 66.667 0.30 0.00 0.00 2.74
1157 2503 2.304470 TGATCGGAGACAAAATCCACCA 59.696 45.455 0.00 0.00 42.51 4.17
1158 2504 2.985896 TGATCGGAGACAAAATCCACC 58.014 47.619 0.00 0.00 42.51 4.61
1159 2505 3.561725 GGATGATCGGAGACAAAATCCAC 59.438 47.826 0.00 0.00 42.51 4.02
1171 2517 1.116308 TAGGCAAACGGATGATCGGA 58.884 50.000 7.02 0.00 0.00 4.55
1388 2749 2.806244 CGTGGAACTGAAACTTGGGTAG 59.194 50.000 0.00 0.00 31.75 3.18
1998 3514 2.095372 GCCTCCACCTTAAAATTCGTCG 59.905 50.000 0.00 0.00 0.00 5.12
2003 3519 3.165071 CACTGGCCTCCACCTTAAAATT 58.835 45.455 3.32 0.00 0.00 1.82
2043 3559 3.076621 GCACACTTGATCAGAACCATCA 58.923 45.455 0.00 0.00 0.00 3.07
2128 3646 5.900123 AGTTAGGCATACTGGACTACAAGAT 59.100 40.000 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.