Multiple sequence alignment - TraesCS2D01G089100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G089100 chr2D 100.000 2330 0 0 1 2330 38797830 38800159 0.000000e+00 4303.0
1 TraesCS2D01G089100 chr2D 98.502 1268 18 1 1063 2329 40937720 40938987 0.000000e+00 2235.0
2 TraesCS2D01G089100 chr2D 98.407 1067 16 1 1 1066 40916511 40917577 0.000000e+00 1875.0
3 TraesCS2D01G089100 chr2D 95.238 210 6 2 1 206 38792378 38792587 1.730000e-86 329.0
4 TraesCS2D01G089100 chr2D 90.698 129 12 0 205 333 78766134 78766006 3.080000e-39 172.0
5 TraesCS2D01G089100 chr2A 95.300 1234 52 6 1100 2330 43532060 43533290 0.000000e+00 1953.0
6 TraesCS2D01G089100 chr2A 89.876 1047 91 10 559 1598 43586131 43587169 0.000000e+00 1332.0
7 TraesCS2D01G089100 chr2A 93.677 854 47 4 243 1092 44719387 44720237 0.000000e+00 1271.0
8 TraesCS2D01G089100 chr2A 94.674 751 38 2 1581 2330 43536147 43536896 0.000000e+00 1164.0
9 TraesCS2D01G089100 chr2A 94.872 468 22 2 311 776 43531585 43532052 0.000000e+00 730.0
10 TraesCS2D01G089100 chr2A 79.487 273 56 0 856 1128 44762848 44763120 6.570000e-46 195.0
11 TraesCS2D01G089100 chr2A 83.562 146 17 6 418 561 43565503 43565643 1.880000e-26 130.0
12 TraesCS2D01G089100 chr2B 87.048 1189 117 21 418 1598 67789527 67790686 0.000000e+00 1308.0
13 TraesCS2D01G089100 chr2B 91.396 953 69 7 651 1598 67733357 67734301 0.000000e+00 1293.0
14 TraesCS2D01G089100 chr2B 88.196 754 86 3 847 1598 67776763 67777515 0.000000e+00 896.0
15 TraesCS2D01G089100 chr2B 89.984 639 56 4 741 1375 67685891 67686525 0.000000e+00 819.0
16 TraesCS2D01G089100 chr2B 95.874 412 14 3 345 753 67673394 67673805 0.000000e+00 664.0
17 TraesCS2D01G089100 chr2B 93.227 251 16 1 1371 1620 67697687 67697937 3.660000e-98 368.0
18 TraesCS2D01G089100 chr2B 95.588 204 8 1 4 206 720616399 720616196 2.230000e-85 326.0
19 TraesCS2D01G089100 chr2B 88.060 268 32 0 1723 1990 67698225 67698492 3.740000e-83 318.0
20 TraesCS2D01G089100 chr2B 90.783 217 20 0 2114 2330 67698510 67698726 8.140000e-75 291.0
21 TraesCS2D01G089100 chr2B 90.395 177 13 3 417 591 67733185 67733359 1.800000e-56 230.0
22 TraesCS2D01G089100 chr2B 88.276 145 12 2 651 795 67747933 67748072 3.980000e-38 169.0
23 TraesCS2D01G089100 chr2B 93.151 73 5 0 1654 1726 67697938 67698010 8.800000e-20 108.0
24 TraesCS2D01G089100 chr1B 97.101 207 5 1 1 206 577836571 577836777 4.770000e-92 348.0
25 TraesCS2D01G089100 chr1B 95.169 207 8 2 1 206 577877348 577877553 2.230000e-85 326.0
26 TraesCS2D01G089100 chr1B 95.169 207 9 1 1 206 656789739 656789945 2.230000e-85 326.0
27 TraesCS2D01G089100 chr1B 94.712 208 10 1 1 207 488203314 488203521 2.890000e-84 322.0
28 TraesCS2D01G089100 chr1B 89.831 59 4 2 2034 2091 407913964 407913907 8.930000e-10 75.0
29 TraesCS2D01G089100 chr5B 96.585 205 6 1 1 204 222422212 222422008 2.870000e-89 339.0
30 TraesCS2D01G089100 chr5B 93.519 216 11 3 1 215 501420506 501420719 3.740000e-83 318.0
31 TraesCS2D01G089100 chr5B 91.406 128 11 0 210 337 429619585 429619458 2.380000e-40 176.0
32 TraesCS2D01G089100 chrUn 79.487 273 56 0 856 1128 332241867 332241595 6.570000e-46 195.0
33 TraesCS2D01G089100 chrUn 89.394 132 14 0 205 336 108810961 108810830 1.430000e-37 167.0
34 TraesCS2D01G089100 chrUn 90.741 54 3 2 2036 2088 340127700 340127752 1.160000e-08 71.3
35 TraesCS2D01G089100 chrUn 90.741 54 3 2 2036 2088 364704629 364704681 1.160000e-08 71.3
36 TraesCS2D01G089100 chr1A 91.176 136 10 2 202 336 366266155 366266289 1.420000e-42 183.0
37 TraesCS2D01G089100 chr7D 90.698 129 12 0 205 333 525721092 525720964 3.080000e-39 172.0
38 TraesCS2D01G089100 chr7D 82.114 123 14 7 1996 2114 107811023 107810905 5.300000e-17 99.0
39 TraesCS2D01G089100 chr5D 89.474 133 14 0 205 337 362997558 362997426 3.980000e-38 169.0
40 TraesCS2D01G089100 chr3D 89.394 132 14 0 205 336 454756506 454756375 1.430000e-37 167.0
41 TraesCS2D01G089100 chr7B 90.000 60 5 1 1665 1724 496878201 496878259 2.480000e-10 76.8
42 TraesCS2D01G089100 chr5A 89.474 57 4 2 2036 2091 560134779 560134724 1.160000e-08 71.3
43 TraesCS2D01G089100 chr5A 88.136 59 5 2 2034 2091 708152318 708152261 4.150000e-08 69.4
44 TraesCS2D01G089100 chr5A 83.824 68 9 2 1996 2062 424243567 424243501 1.930000e-06 63.9
45 TraesCS2D01G089100 chr3B 90.741 54 3 2 2036 2088 794696316 794696368 1.160000e-08 71.3
46 TraesCS2D01G089100 chr3A 89.286 56 4 2 2034 2088 50385392 50385446 4.150000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G089100 chr2D 38797830 38800159 2329 False 4303.000000 4303 100.000000 1 2330 1 chr2D.!!$F2 2329
1 TraesCS2D01G089100 chr2D 40937720 40938987 1267 False 2235.000000 2235 98.502000 1063 2329 1 chr2D.!!$F4 1266
2 TraesCS2D01G089100 chr2D 40916511 40917577 1066 False 1875.000000 1875 98.407000 1 1066 1 chr2D.!!$F3 1065
3 TraesCS2D01G089100 chr2A 43586131 43587169 1038 False 1332.000000 1332 89.876000 559 1598 1 chr2A.!!$F2 1039
4 TraesCS2D01G089100 chr2A 43531585 43536896 5311 False 1282.333333 1953 94.948667 311 2330 3 chr2A.!!$F5 2019
5 TraesCS2D01G089100 chr2A 44719387 44720237 850 False 1271.000000 1271 93.677000 243 1092 1 chr2A.!!$F3 849
6 TraesCS2D01G089100 chr2B 67789527 67790686 1159 False 1308.000000 1308 87.048000 418 1598 1 chr2B.!!$F5 1180
7 TraesCS2D01G089100 chr2B 67776763 67777515 752 False 896.000000 896 88.196000 847 1598 1 chr2B.!!$F4 751
8 TraesCS2D01G089100 chr2B 67685891 67686525 634 False 819.000000 819 89.984000 741 1375 1 chr2B.!!$F2 634
9 TraesCS2D01G089100 chr2B 67733185 67734301 1116 False 761.500000 1293 90.895500 417 1598 2 chr2B.!!$F7 1181
10 TraesCS2D01G089100 chr2B 67697687 67698726 1039 False 271.250000 368 91.305250 1371 2330 4 chr2B.!!$F6 959

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
130 131 3.30572 TGCTTAGGAATCGGTATGAGGT 58.694 45.455 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1775 5613 1.566018 GCACGCTTGCTTCGGTTAGT 61.566 55.0 8.12 0.0 46.17 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 3.305720 TGCTTAGGAATCGGTATGAGGT 58.694 45.455 0.00 0.00 0.00 3.85
226 227 5.545658 ATTGCAACAAAGGACTACATACG 57.454 39.130 0.00 0.00 0.00 3.06
1574 1587 9.726438 AAGTCTCAAGTAACTGCACTAATTTAT 57.274 29.630 0.00 0.00 0.00 1.40
1870 5708 1.466950 CGCACGTGTGGGTTATTTCAT 59.533 47.619 21.32 0.00 38.53 2.57
2133 5972 1.928503 GGTTGAAGACAAACGTCGTGA 59.071 47.619 0.00 0.00 38.51 4.35
2163 6002 2.027100 AGGGAAAGCTAGAACGGAAAGG 60.027 50.000 0.00 0.00 0.00 3.11
2195 6034 0.109597 GGTTCAAGCCAACATGAGCG 60.110 55.000 0.00 0.00 0.00 5.03
2207 6046 2.722094 ACATGAGCGCCTATTGGAAAA 58.278 42.857 2.29 0.00 34.57 2.29
2271 6110 3.426568 GAGGCGCCTGTGTTGAGC 61.427 66.667 38.41 13.51 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 1.336440 GCATGGCAAATACGGTATGCA 59.664 47.619 13.88 0.0 41.80 3.96
226 227 8.734386 AGATTGTAGATTCACTCATTTTGTTCC 58.266 33.333 0.00 0.0 0.00 3.62
414 416 6.546772 ACTGTGCTACTCCTTATAGTTAGTCC 59.453 42.308 0.00 0.0 0.00 3.85
1775 5613 1.566018 GCACGCTTGCTTCGGTTAGT 61.566 55.000 8.12 0.0 46.17 2.24
1870 5708 2.150719 TTCGCCTCTCCCCCAACAA 61.151 57.895 0.00 0.0 0.00 2.83
2133 5972 1.689273 CTAGCTTTCCCTCCGCACTAT 59.311 52.381 0.00 0.0 0.00 2.12
2163 6002 2.287248 GCTTGAACCTTCAGTGACTTGC 60.287 50.000 0.00 0.0 38.61 4.01
2195 6034 3.427098 GCTACAACGGTTTTCCAATAGGC 60.427 47.826 0.00 0.0 40.70 3.93
2207 6046 3.119101 CCACAGAATCTAGCTACAACGGT 60.119 47.826 0.00 0.0 0.00 4.83
2271 6110 2.790433 TCCCCAAAAGAACTCCAATCG 58.210 47.619 0.00 0.0 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.