Multiple sequence alignment - TraesCS2D01G071300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G071300 chr2D 100.000 2503 0 0 1 2503 30239328 30236826 0.000000e+00 4623.0
1 TraesCS2D01G071300 chr2D 96.206 2346 70 9 53 2385 30159687 30157348 0.000000e+00 3821.0
2 TraesCS2D01G071300 chr2D 95.867 2347 75 10 53 2385 30098036 30095698 0.000000e+00 3777.0
3 TraesCS2D01G071300 chr2D 95.824 2347 71 15 53 2385 30231668 30229335 0.000000e+00 3766.0
4 TraesCS2D01G071300 chr2D 98.363 1771 29 0 733 2503 30166586 30164816 0.000000e+00 3110.0
5 TraesCS2D01G071300 chr2D 98.306 1771 28 1 733 2503 30122736 30120968 0.000000e+00 3103.0
6 TraesCS2D01G071300 chr2D 93.280 744 28 9 4 738 30213981 30213251 0.000000e+00 1077.0
7 TraesCS2D01G071300 chr2D 93.011 744 30 9 4 738 30139675 30138945 0.000000e+00 1066.0
8 TraesCS2D01G071300 chr2D 95.122 123 5 1 2381 2503 30085523 30085402 2.540000e-45 193.0
9 TraesCS2D01G071300 chr2D 95.122 123 5 1 2381 2503 30147206 30147085 2.540000e-45 193.0
10 TraesCS2D01G071300 chr2D 94.309 123 6 1 2381 2503 30219216 30219095 1.180000e-43 187.0
11 TraesCS2D01G071300 chr2D 93.496 123 7 1 2381 2503 30199991 30199870 5.500000e-42 182.0
12 TraesCS2D01G071300 chrUn 96.249 2346 69 10 53 2385 311530759 311533098 0.000000e+00 3827.0
13 TraesCS2D01G071300 chrUn 96.378 2043 60 7 53 2087 335402663 335400627 0.000000e+00 3350.0
14 TraesCS2D01G071300 chrUn 96.708 1762 45 6 53 1806 338699853 338698097 0.000000e+00 2920.0
15 TraesCS2D01G071300 chrUn 98.954 1339 13 1 1165 2503 295794883 295796220 0.000000e+00 2394.0
16 TraesCS2D01G071300 chrUn 96.560 1192 30 4 53 1238 363756466 363757652 0.000000e+00 1964.0
17 TraesCS2D01G071300 chr2B 95.879 2208 74 8 1 2200 49115120 49117318 0.000000e+00 3557.0
18 TraesCS2D01G071300 chr6D 85.333 75 11 0 4 78 224806735 224806661 7.420000e-11 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G071300 chr2D 30236826 30239328 2502 True 4623 4623 100.000 1 2503 1 chr2D.!!$R12 2502
1 TraesCS2D01G071300 chr2D 30157348 30159687 2339 True 3821 3821 96.206 53 2385 1 chr2D.!!$R6 2332
2 TraesCS2D01G071300 chr2D 30095698 30098036 2338 True 3777 3777 95.867 53 2385 1 chr2D.!!$R2 2332
3 TraesCS2D01G071300 chr2D 30229335 30231668 2333 True 3766 3766 95.824 53 2385 1 chr2D.!!$R11 2332
4 TraesCS2D01G071300 chr2D 30164816 30166586 1770 True 3110 3110 98.363 733 2503 1 chr2D.!!$R7 1770
5 TraesCS2D01G071300 chr2D 30120968 30122736 1768 True 3103 3103 98.306 733 2503 1 chr2D.!!$R3 1770
6 TraesCS2D01G071300 chr2D 30213251 30213981 730 True 1077 1077 93.280 4 738 1 chr2D.!!$R9 734
7 TraesCS2D01G071300 chr2D 30138945 30139675 730 True 1066 1066 93.011 4 738 1 chr2D.!!$R4 734
8 TraesCS2D01G071300 chrUn 311530759 311533098 2339 False 3827 3827 96.249 53 2385 1 chrUn.!!$F2 2332
9 TraesCS2D01G071300 chrUn 335400627 335402663 2036 True 3350 3350 96.378 53 2087 1 chrUn.!!$R1 2034
10 TraesCS2D01G071300 chrUn 338698097 338699853 1756 True 2920 2920 96.708 53 1806 1 chrUn.!!$R2 1753
11 TraesCS2D01G071300 chrUn 295794883 295796220 1337 False 2394 2394 98.954 1165 2503 1 chrUn.!!$F1 1338
12 TraesCS2D01G071300 chrUn 363756466 363757652 1186 False 1964 1964 96.560 53 1238 1 chrUn.!!$F3 1185
13 TraesCS2D01G071300 chr2B 49115120 49117318 2198 False 3557 3557 95.879 1 2200 1 chr2B.!!$F1 2199

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
345 346 2.034558 GGTTGTCCATTGTCCACACTTG 59.965 50.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 2138 1.965414 TACCAGGGAGGCTGAATGAA 58.035 50.0 0.0 0.0 43.14 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 247 7.766738 TGACTCACTAATAACCAAATATTCGCA 59.233 33.333 0.00 0.00 0.00 5.10
345 346 2.034558 GGTTGTCCATTGTCCACACTTG 59.965 50.000 0.00 0.00 0.00 3.16
466 467 2.619074 GCACCATCTGGCTCTAACCTTT 60.619 50.000 0.00 0.00 39.32 3.11
634 644 5.578727 TCAATACCTTTGTTGTTGTTGTTGC 59.421 36.000 0.00 0.00 0.00 4.17
949 959 5.622007 GCTTGAAGTACTAATTTGGCATGCA 60.622 40.000 21.36 2.54 0.00 3.96
2466 2485 2.968574 AGCCTTCGACCATCTATGTCAT 59.031 45.455 0.00 0.00 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 1.463444 CCCACGCTGTTGTTAAGTAGC 59.537 52.381 0.00 0.0 0.00 3.58
213 214 7.684317 TTGGTTATTAGTGAGTCATATCCCA 57.316 36.000 0.00 0.0 0.00 4.37
302 303 3.958147 CTCCACCGCCTTCACGCAT 62.958 63.158 0.00 0.0 0.00 4.73
305 306 0.249073 CTATCTCCACCGCCTTCACG 60.249 60.000 0.00 0.0 0.00 4.35
345 346 5.386060 AGGTATTTATAGCTGGGAAAAGGC 58.614 41.667 0.00 0.0 39.43 4.35
616 626 3.862845 GGTAGCAACAACAACAACAAAGG 59.137 43.478 0.00 0.0 0.00 3.11
620 630 2.164624 GGTGGTAGCAACAACAACAACA 59.835 45.455 4.77 0.0 30.29 3.33
621 631 2.480587 GGGTGGTAGCAACAACAACAAC 60.481 50.000 12.80 0.0 30.29 3.32
622 632 1.751924 GGGTGGTAGCAACAACAACAA 59.248 47.619 12.80 0.0 30.29 2.83
623 633 1.341089 TGGGTGGTAGCAACAACAACA 60.341 47.619 12.80 0.0 30.29 3.33
634 644 8.049117 ACATAAATGCATATAGATGGGTGGTAG 58.951 37.037 0.00 0.0 33.26 3.18
908 918 8.579682 ACTTCAAGCATATTGTTTTTCTTGAC 57.420 30.769 0.00 0.0 39.40 3.18
2125 2138 1.965414 TACCAGGGAGGCTGAATGAA 58.035 50.000 0.00 0.0 43.14 2.57
2126 2139 2.050144 GATACCAGGGAGGCTGAATGA 58.950 52.381 0.00 0.0 43.14 2.57
2192 2206 5.198965 ACAACGCTCCTCTATACTTCCTTA 58.801 41.667 0.00 0.0 0.00 2.69
2238 2257 2.394930 TTGGATGTATGGTGTGTCGG 57.605 50.000 0.00 0.0 0.00 4.79
2466 2485 1.908619 TCAAGTAGAGGCCAGATGCAA 59.091 47.619 5.01 0.0 43.89 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.