Multiple sequence alignment - TraesCS2D01G071200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G071200 chr2D 100.000 2796 0 0 1 2796 30231982 30229187 0.000000e+00 5164
1 TraesCS2D01G071200 chr2D 98.216 2803 41 5 1 2796 30098350 30095550 0.000000e+00 4891
2 TraesCS2D01G071200 chr2D 98.145 2803 44 5 1 2796 30160001 30157200 0.000000e+00 4881
3 TraesCS2D01G071200 chr2D 95.824 2347 71 15 315 2648 30239276 30236944 0.000000e+00 3766
4 TraesCS2D01G071200 chr2D 95.364 1661 63 9 994 2648 30166586 30164934 0.000000e+00 2628
5 TraesCS2D01G071200 chr2D 95.184 1661 64 10 994 2648 30122736 30121086 0.000000e+00 2610
6 TraesCS2D01G071200 chr2D 90.481 1891 143 18 344 2208 29886027 29884148 0.000000e+00 2460
7 TraesCS2D01G071200 chr2D 96.429 140 5 0 18 157 30139763 30139624 6.020000e-57 231
8 TraesCS2D01G071200 chr2D 91.720 157 13 0 1 157 30239430 30239274 4.690000e-53 219
9 TraesCS2D01G071200 chrUn 98.751 2803 27 5 1 2796 311530445 311533246 0.000000e+00 4975
10 TraesCS2D01G071200 chrUn 98.299 2351 32 5 1 2344 335402977 335400628 0.000000e+00 4113
11 TraesCS2D01G071200 chrUn 98.600 2071 23 3 1 2065 338700167 338698097 0.000000e+00 3659
12 TraesCS2D01G071200 chrUn 98.867 1501 15 2 1 1499 363756152 363757652 0.000000e+00 2676
13 TraesCS2D01G071200 chrUn 95.714 140 6 0 18 157 464643521 464643660 2.800000e-55 226
14 TraesCS2D01G071200 chr2B 95.725 2152 78 10 315 2457 49115172 49117318 0.000000e+00 3452
15 TraesCS2D01G071200 chr2B 94.046 823 45 4 415 1233 49153849 49154671 0.000000e+00 1245
16 TraesCS2D01G071200 chr2B 97.351 151 4 0 2646 2796 624415280 624415430 9.940000e-65 257
17 TraesCS2D01G071200 chr3B 95.152 165 8 0 152 316 79117115 79116951 7.680000e-66 261
18 TraesCS2D01G071200 chr7D 97.368 152 4 0 2645 2796 213402107 213402258 2.760000e-65 259
19 TraesCS2D01G071200 chr1A 94.118 170 9 1 147 316 254349083 254348915 9.940000e-65 257
20 TraesCS2D01G071200 chr4B 96.753 154 4 1 2644 2796 322390788 322390941 3.570000e-64 255
21 TraesCS2D01G071200 chr4B 96.753 154 4 1 2644 2796 322444118 322444271 3.570000e-64 255
22 TraesCS2D01G071200 chr1D 93.143 175 10 1 153 325 121624624 121624450 3.570000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G071200 chr2D 30229187 30231982 2795 True 5164.0 5164 100.000 1 2796 1 chr2D.!!$R7 2795
1 TraesCS2D01G071200 chr2D 30095550 30098350 2800 True 4891.0 4891 98.216 1 2796 1 chr2D.!!$R2 2795
2 TraesCS2D01G071200 chr2D 30157200 30160001 2801 True 4881.0 4881 98.145 1 2796 1 chr2D.!!$R5 2795
3 TraesCS2D01G071200 chr2D 30164934 30166586 1652 True 2628.0 2628 95.364 994 2648 1 chr2D.!!$R6 1654
4 TraesCS2D01G071200 chr2D 30121086 30122736 1650 True 2610.0 2610 95.184 994 2648 1 chr2D.!!$R3 1654
5 TraesCS2D01G071200 chr2D 29884148 29886027 1879 True 2460.0 2460 90.481 344 2208 1 chr2D.!!$R1 1864
6 TraesCS2D01G071200 chr2D 30236944 30239430 2486 True 1992.5 3766 93.772 1 2648 2 chr2D.!!$R8 2647
7 TraesCS2D01G071200 chrUn 311530445 311533246 2801 False 4975.0 4975 98.751 1 2796 1 chrUn.!!$F1 2795
8 TraesCS2D01G071200 chrUn 335400628 335402977 2349 True 4113.0 4113 98.299 1 2344 1 chrUn.!!$R1 2343
9 TraesCS2D01G071200 chrUn 338698097 338700167 2070 True 3659.0 3659 98.600 1 2065 1 chrUn.!!$R2 2064
10 TraesCS2D01G071200 chrUn 363756152 363757652 1500 False 2676.0 2676 98.867 1 1499 1 chrUn.!!$F2 1498
11 TraesCS2D01G071200 chr2B 49115172 49117318 2146 False 3452.0 3452 95.725 315 2457 1 chr2B.!!$F1 2142
12 TraesCS2D01G071200 chr2B 49153849 49154671 822 False 1245.0 1245 94.046 415 1233 1 chr2B.!!$F2 818

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
775 787 3.950395 GCCTTGTCTTATCATCAGGCTTT 59.050 43.478 0.58 0.0 38.1 3.51 F
800 812 4.021981 GGAGCTTTTAGTGTCCATGCTTTT 60.022 41.667 0.00 0.0 0.0 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1701 1731 1.365894 TAGGACCGAGGGCCTCCATA 61.366 60.000 27.36 12.78 32.93 2.74 R
2344 2380 3.793801 GCCAACGTTTGTGCTTGTTGATA 60.794 43.478 0.00 0.00 43.26 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
775 787 3.950395 GCCTTGTCTTATCATCAGGCTTT 59.050 43.478 0.58 0.0 38.10 3.51
779 791 5.178096 TGTCTTATCATCAGGCTTTTGGA 57.822 39.130 0.00 0.0 0.00 3.53
794 806 5.712152 CTTTTGGAGCTTTTAGTGTCCAT 57.288 39.130 0.00 0.0 38.87 3.41
800 812 4.021981 GGAGCTTTTAGTGTCCATGCTTTT 60.022 41.667 0.00 0.0 0.00 2.27
972 991 5.670792 TTCCACGTTGATGTTATCTAGGT 57.329 39.130 0.00 0.0 34.43 3.08
1701 1731 4.972751 ATTTGTGCCCAAACCAATAAGT 57.027 36.364 0.00 0.0 43.03 2.24
2184 2220 2.292267 CCATAACTCTGCCATGTCCAC 58.708 52.381 0.00 0.0 0.00 4.02
2344 2380 5.017490 TCTCGACCTTTCTCCTCTTGTAAT 58.983 41.667 0.00 0.0 0.00 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
775 787 2.819608 GCATGGACACTAAAAGCTCCAA 59.180 45.455 0.00 0.00 36.39 3.53
779 791 4.584325 TGAAAAGCATGGACACTAAAAGCT 59.416 37.500 0.00 0.00 0.00 3.74
794 806 3.950397 ACATTCTCCGGTATGAAAAGCA 58.050 40.909 16.87 0.00 0.00 3.91
800 812 4.341235 CACCTCTAACATTCTCCGGTATGA 59.659 45.833 16.87 5.88 0.00 2.15
1202 1222 1.368345 TTCTTGATCCACGCATGCCG 61.368 55.000 13.15 10.04 44.21 5.69
1575 1605 1.470098 GCACGGATCTTCACAATTGCT 59.530 47.619 5.05 0.00 0.00 3.91
1701 1731 1.365894 TAGGACCGAGGGCCTCCATA 61.366 60.000 27.36 12.78 32.93 2.74
1948 1979 6.858478 GCCAAAAACAGAAAGACTTGTAGATC 59.142 38.462 0.00 0.00 0.00 2.75
2344 2380 3.793801 GCCAACGTTTGTGCTTGTTGATA 60.794 43.478 0.00 0.00 43.26 2.15
2596 2633 8.990163 AAACTAACTTTACTTCTCCATTTCCA 57.010 30.769 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.