Multiple sequence alignment - TraesCS2D01G071100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G071100 chr2D 100.000 2503 0 0 1 2503 30159738 30157236 0.000000e+00 4623.0
1 TraesCS2D01G071100 chr2D 98.642 2504 31 2 1 2503 30098087 30095586 0.000000e+00 4433.0
2 TraesCS2D01G071100 chr2D 98.123 2504 39 5 1 2503 30231719 30229223 0.000000e+00 4357.0
3 TraesCS2D01G071100 chr2D 96.206 2346 70 9 52 2391 30239276 30236944 0.000000e+00 3821.0
4 TraesCS2D01G071100 chr2D 95.964 1660 59 4 733 2391 30166586 30164934 0.000000e+00 2687.0
5 TraesCS2D01G071100 chr2D 95.783 1660 60 5 733 2391 30122736 30121086 0.000000e+00 2669.0
6 TraesCS2D01G071100 chr2D 92.188 64 4 1 1 63 73737318 73737381 3.430000e-14 89.8
7 TraesCS2D01G071100 chr2D 90.769 65 5 1 6 70 644287387 644287450 4.440000e-13 86.1
8 TraesCS2D01G071100 chrUn 98.842 2504 27 2 1 2503 311530708 311533210 0.000000e+00 4462.0
9 TraesCS2D01G071100 chrUn 98.803 2089 23 2 1 2088 335402714 335400627 0.000000e+00 3718.0
10 TraesCS2D01G071100 chrUn 99.060 1808 16 1 1 1807 338699904 338698097 0.000000e+00 3243.0
11 TraesCS2D01G071100 chrUn 99.111 1238 11 0 1 1238 363756415 363757652 0.000000e+00 2226.0
12 TraesCS2D01G071100 chr2B 96.097 2152 76 5 52 2200 49115172 49117318 0.000000e+00 3502.0
13 TraesCS2D01G071100 chr2B 95.146 824 38 2 152 973 49153849 49154672 0.000000e+00 1299.0
14 TraesCS2D01G071100 chr2B 97.087 103 3 0 52 154 49153635 49153737 9.200000e-40 174.0
15 TraesCS2D01G071100 chr3B 95.161 124 6 0 2379 2502 116771878 116772001 1.960000e-46 196.0
16 TraesCS2D01G071100 chr7B 94.488 127 5 2 2377 2502 555242433 555242308 7.060000e-46 195.0
17 TraesCS2D01G071100 chr6D 94.488 127 6 1 2376 2502 451991925 451992050 7.060000e-46 195.0
18 TraesCS2D01G071100 chr3D 91.034 145 9 4 2360 2502 433354215 433354073 2.540000e-45 193.0
19 TraesCS2D01G071100 chr1D 91.935 62 5 0 1 62 121624511 121624450 1.230000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G071100 chr2D 30157236 30159738 2502 True 4623.0 4623 100.0000 1 2503 1 chr2D.!!$R3 2502
1 TraesCS2D01G071100 chr2D 30095586 30098087 2501 True 4433.0 4433 98.6420 1 2503 1 chr2D.!!$R1 2502
2 TraesCS2D01G071100 chr2D 30229223 30231719 2496 True 4357.0 4357 98.1230 1 2503 1 chr2D.!!$R5 2502
3 TraesCS2D01G071100 chr2D 30236944 30239276 2332 True 3821.0 3821 96.2060 52 2391 1 chr2D.!!$R6 2339
4 TraesCS2D01G071100 chr2D 30164934 30166586 1652 True 2687.0 2687 95.9640 733 2391 1 chr2D.!!$R4 1658
5 TraesCS2D01G071100 chr2D 30121086 30122736 1650 True 2669.0 2669 95.7830 733 2391 1 chr2D.!!$R2 1658
6 TraesCS2D01G071100 chrUn 311530708 311533210 2502 False 4462.0 4462 98.8420 1 2503 1 chrUn.!!$F1 2502
7 TraesCS2D01G071100 chrUn 335400627 335402714 2087 True 3718.0 3718 98.8030 1 2088 1 chrUn.!!$R1 2087
8 TraesCS2D01G071100 chrUn 338698097 338699904 1807 True 3243.0 3243 99.0600 1 1807 1 chrUn.!!$R2 1806
9 TraesCS2D01G071100 chrUn 363756415 363757652 1237 False 2226.0 2226 99.1110 1 1238 1 chrUn.!!$F2 1237
10 TraesCS2D01G071100 chr2B 49115172 49117318 2146 False 3502.0 3502 96.0970 52 2200 1 chr2B.!!$F1 2148
11 TraesCS2D01G071100 chr2B 49153635 49154672 1037 False 736.5 1299 96.1165 52 973 2 chr2B.!!$F2 921

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
20 21 2.576615 GTGGCCCATAGTGAAATCTCC 58.423 52.381 0.00 0.00 0.00 3.71 F
90 91 5.542635 TCCTAGTAGTGGTATATTGGCCAAG 59.457 44.000 24.94 4.24 36.41 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1182 1302 3.837731 TCATGACGGGCATATCCTTATCA 59.162 43.478 0.0 0.0 34.82 2.15 R
2088 2209 1.917303 CCAACGTTTGTGCTTGTTGAC 59.083 47.619 0.0 0.0 43.26 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.576615 GTGGCCCATAGTGAAATCTCC 58.423 52.381 0.00 0.00 0.00 3.71
90 91 5.542635 TCCTAGTAGTGGTATATTGGCCAAG 59.457 44.000 24.94 4.24 36.41 3.61
243 359 9.832445 ATGACTCACTAATAACCAAATATTCGT 57.168 29.630 0.00 0.00 0.00 3.85
628 745 9.045223 TGATCTGTTAATCAATATCTTCGTTGG 57.955 33.333 0.00 0.00 32.80 3.77
1182 1302 8.079203 GGGAAAAAGTTTGACATTGTTTTGTTT 58.921 29.630 0.00 0.00 0.00 2.83
1374 1495 1.133199 AGATTGTTGGGGTTTCTGCCA 60.133 47.619 0.00 0.00 0.00 4.92
2088 2209 3.243336 CGACCTTTCTCCTCTTGTAACG 58.757 50.000 0.00 0.00 0.00 3.18
2231 2353 6.463614 GGAGCATTGTGTCATATCCTACTTCT 60.464 42.308 0.00 0.00 0.00 2.85
2430 2552 4.817286 AGGGGATCTATCGTAGTCCTTTT 58.183 43.478 0.00 0.00 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 7.277396 TCCGTTCCTAAATATAAGTCTTTGGG 58.723 38.462 0.0 0.0 35.10 4.12
1182 1302 3.837731 TCATGACGGGCATATCCTTATCA 59.162 43.478 0.0 0.0 34.82 2.15
1807 1928 4.141181 TGGCCATTAACTGCTAATCCAGAT 60.141 41.667 0.0 0.0 36.67 2.90
2088 2209 1.917303 CCAACGTTTGTGCTTGTTGAC 59.083 47.619 0.0 0.0 43.26 3.18
2231 2353 3.081061 GGTGTGTTGATGCCAATCACTA 58.919 45.455 0.0 0.0 42.60 2.74
2430 2552 4.768448 TGGGTTCGACACTCTTACTTATCA 59.232 41.667 0.0 0.0 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.