Multiple sequence alignment - TraesCS2D01G071000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G071000 chr2D 100.000 2504 0 0 1 2504 30098087 30095584 0.000000e+00 4625.0
1 TraesCS2D01G071000 chr2D 98.643 2506 31 2 1 2504 30159738 30157234 0.000000e+00 4436.0
2 TraesCS2D01G071000 chr2D 98.125 2506 38 5 1 2504 30231719 30229221 0.000000e+00 4359.0
3 TraesCS2D01G071000 chr2D 95.867 2347 75 10 52 2390 30239276 30236944 0.000000e+00 3777.0
4 TraesCS2D01G071000 chr2D 95.304 1661 67 6 733 2390 30166586 30164934 0.000000e+00 2625.0
5 TraesCS2D01G071000 chr2D 95.184 1661 67 7 733 2390 30122736 30121086 0.000000e+00 2612.0
6 TraesCS2D01G071000 chr2D 93.750 64 3 1 1 63 73737318 73737381 7.370000e-16 95.3
7 TraesCS2D01G071000 chr2D 92.308 65 4 1 6 70 644287387 644287450 9.540000e-15 91.6
8 TraesCS2D01G071000 chrUn 98.763 2506 28 2 1 2504 311530708 311533212 0.000000e+00 4453.0
9 TraesCS2D01G071000 chrUn 98.660 2089 27 1 1 2089 335402714 335400627 0.000000e+00 3701.0
10 TraesCS2D01G071000 chrUn 99.060 1808 17 0 1 1808 338699904 338698097 0.000000e+00 3245.0
11 TraesCS2D01G071000 chrUn 99.192 1238 10 0 1 1238 363756415 363757652 0.000000e+00 2231.0
12 TraesCS2D01G071000 chr2B 96.050 2152 78 4 52 2201 49115172 49117318 0.000000e+00 3496.0
13 TraesCS2D01G071000 chr2B 94.897 823 40 2 152 972 49153849 49154671 0.000000e+00 1286.0
14 TraesCS2D01G071000 chr2B 98.058 103 2 0 52 154 49153635 49153737 1.980000e-41 180.0
15 TraesCS2D01G071000 chr7B 93.846 130 6 2 2376 2504 555242433 555242305 7.070000e-46 195.0
16 TraesCS2D01G071000 chr3D 91.034 145 9 4 2359 2501 433354215 433354073 2.540000e-45 193.0
17 TraesCS2D01G071000 chr3A 90.141 142 12 2 2361 2501 720731216 720731356 1.530000e-42 183.0
18 TraesCS2D01G071000 chr3A 90.141 142 12 2 2361 2501 720757550 720757690 1.530000e-42 183.0
19 TraesCS2D01G071000 chr1D 93.548 62 4 0 1 62 121624511 121624450 2.650000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G071000 chr2D 30095584 30098087 2503 True 4625 4625 100.0000 1 2504 1 chr2D.!!$R1 2503
1 TraesCS2D01G071000 chr2D 30157234 30159738 2504 True 4436 4436 98.6430 1 2504 1 chr2D.!!$R3 2503
2 TraesCS2D01G071000 chr2D 30229221 30231719 2498 True 4359 4359 98.1250 1 2504 1 chr2D.!!$R5 2503
3 TraesCS2D01G071000 chr2D 30236944 30239276 2332 True 3777 3777 95.8670 52 2390 1 chr2D.!!$R6 2338
4 TraesCS2D01G071000 chr2D 30164934 30166586 1652 True 2625 2625 95.3040 733 2390 1 chr2D.!!$R4 1657
5 TraesCS2D01G071000 chr2D 30121086 30122736 1650 True 2612 2612 95.1840 733 2390 1 chr2D.!!$R2 1657
6 TraesCS2D01G071000 chrUn 311530708 311533212 2504 False 4453 4453 98.7630 1 2504 1 chrUn.!!$F1 2503
7 TraesCS2D01G071000 chrUn 335400627 335402714 2087 True 3701 3701 98.6600 1 2089 1 chrUn.!!$R1 2088
8 TraesCS2D01G071000 chrUn 338698097 338699904 1807 True 3245 3245 99.0600 1 1808 1 chrUn.!!$R2 1807
9 TraesCS2D01G071000 chrUn 363756415 363757652 1237 False 2231 2231 99.1920 1 1238 1 chrUn.!!$F2 1237
10 TraesCS2D01G071000 chr2B 49115172 49117318 2146 False 3496 3496 96.0500 52 2201 1 chr2B.!!$F1 2149
11 TraesCS2D01G071000 chr2B 49153635 49154671 1036 False 733 1286 96.4775 52 972 2 chr2B.!!$F2 920

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
547 664 1.273048 TGTCCACGCTTTACATACCGT 59.727 47.619 0.0 0.0 0.0 4.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2454 2577 2.026822 TGTCATTTCCTTCTGCTCCTCC 60.027 50.0 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
547 664 1.273048 TGTCCACGCTTTACATACCGT 59.727 47.619 0.00 0.00 0.00 4.83
606 723 8.034804 GGTGGAAGTATGCATTTTAGTTTGATT 58.965 33.333 3.54 0.00 0.00 2.57
948 1068 5.476599 TGCTTGAAGTACTAATTTGGCATGT 59.523 36.000 0.00 0.00 0.00 3.21
1203 1323 4.274978 TCGATAAGGATATGCCCGTCATA 58.725 43.478 0.00 0.00 41.52 2.15
1635 1755 8.733458 TGATTTGAGAAGTTCATGTTAATGGAG 58.267 33.333 5.50 0.00 35.27 3.86
1875 1995 6.533730 TGTCCACTATTATGAATCCATCACC 58.466 40.000 0.00 0.00 41.93 4.02
1931 2051 1.830279 AACTCTGCCATGTCCATGTG 58.170 50.000 6.53 0.12 37.11 3.21
2029 2149 6.206634 CAGCAAGGTTCAAAGACCACTTATTA 59.793 38.462 0.00 0.00 42.35 0.98
2226 2347 1.139058 AGGAGCGTTGTGTCATATCCC 59.861 52.381 0.00 0.00 0.00 3.85
2454 2577 3.662247 AGTAAGAGTGTCGAACCCAAG 57.338 47.619 0.00 0.00 0.00 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
547 664 8.453681 TGGTATAGATCCACCTCTAACATTCTA 58.546 37.037 9.46 0.00 35.73 2.10
835 955 0.846401 CGAGGACATCGCATAACACG 59.154 55.000 0.00 0.00 45.98 4.49
1203 1323 7.272144 AGAATTAATTACCTCTGGACCAGTT 57.728 36.000 21.06 9.43 32.61 3.16
1402 1522 3.056607 ACAAATAAATCAGCACCAGCACC 60.057 43.478 0.00 0.00 45.49 5.01
1551 1671 7.699812 GGAGATTGAAGCAAACATAGATCAAAC 59.300 37.037 0.00 0.00 31.37 2.93
2029 2149 8.302438 GCTAATGCCATAAATGCTAAGATTTCT 58.698 33.333 0.00 0.00 0.00 2.52
2100 2220 2.235016 AGAGCCAAATGCCAACGTTTA 58.765 42.857 0.00 0.00 42.71 2.01
2454 2577 2.026822 TGTCATTTCCTTCTGCTCCTCC 60.027 50.000 0.00 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.