Multiple sequence alignment - TraesCS2D01G069200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G069200 chr2D 100.000 2840 0 0 1 2840 28986053 28983214 0.000000e+00 5245
1 TraesCS2D01G069200 chr2D 98.277 2844 34 4 1 2840 28993368 28990536 0.000000e+00 4966
2 TraesCS2D01G069200 chr2D 98.274 869 15 0 1027 1895 28961734 28960866 0.000000e+00 1522
3 TraesCS2D01G069200 chr2D 93.060 317 22 0 1516 1832 29149742 29150058 5.540000e-127 464
4 TraesCS2D01G069200 chr3D 97.989 945 18 1 1897 2840 56222694 56223638 0.000000e+00 1639
5 TraesCS2D01G069200 chr3D 97.879 943 20 0 1898 2840 508622428 508623370 0.000000e+00 1631
6 TraesCS2D01G069200 chr1D 97.884 945 19 1 1897 2840 219150351 219151295 0.000000e+00 1633
7 TraesCS2D01G069200 chr1D 97.881 944 20 0 1897 2840 350421380 350420437 0.000000e+00 1633
8 TraesCS2D01G069200 chr4D 97.775 944 21 0 1897 2840 12985116 12986059 0.000000e+00 1628
9 TraesCS2D01G069200 chr7D 97.672 945 21 1 1897 2840 501969043 501969987 0.000000e+00 1622
10 TraesCS2D01G069200 chr7D 97.566 945 21 2 1897 2840 45796219 45795276 0.000000e+00 1616
11 TraesCS2D01G069200 chr5D 97.564 944 23 0 1897 2840 365670300 365671243 0.000000e+00 1616
12 TraesCS2D01G069200 chr3B 94.010 1035 33 5 20 1026 800651285 800650252 0.000000e+00 1541
13 TraesCS2D01G069200 chr3B 90.874 1030 66 22 23 1026 410876044 410877071 0.000000e+00 1356
14 TraesCS2D01G069200 chr3B 89.525 1031 71 25 23 1026 802893608 802894628 0.000000e+00 1271
15 TraesCS2D01G069200 chr7B 92.940 1034 34 6 20 1027 706977945 706976925 0.000000e+00 1469
16 TraesCS2D01G069200 chr2B 89.913 1031 67 25 23 1026 69015375 69016395 0.000000e+00 1293
17 TraesCS2D01G069200 chr2B 91.400 814 61 6 1027 1831 46873971 46874784 0.000000e+00 1107
18 TraesCS2D01G069200 chr2B 87.375 602 55 10 1027 1624 46800855 46800271 0.000000e+00 671
19 TraesCS2D01G069200 chr2B 93.717 191 12 0 1624 1814 46754636 46754446 1.290000e-73 287
20 TraesCS2D01G069200 chr1A 89.826 1032 68 25 23 1027 576246834 576247855 0.000000e+00 1290
21 TraesCS2D01G069200 chr6B 89.951 1025 63 24 23 1027 480826838 480827842 0.000000e+00 1286
22 TraesCS2D01G069200 chr3A 89.265 1034 74 25 23 1029 28720656 28719633 0.000000e+00 1260
23 TraesCS2D01G069200 chr7A 84.453 1042 95 33 23 1027 663802691 663803702 0.000000e+00 965
24 TraesCS2D01G069200 chr4A 85.363 895 86 31 23 879 17733728 17732841 0.000000e+00 885
25 TraesCS2D01G069200 chrUn 88.000 600 64 6 1027 1622 17170959 17170364 0.000000e+00 702
26 TraesCS2D01G069200 chrUn 91.459 281 15 3 1624 1895 472783302 472783022 7.430000e-101 377


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G069200 chr2D 28983214 28986053 2839 True 5245 5245 100.000 1 2840 1 chr2D.!!$R2 2839
1 TraesCS2D01G069200 chr2D 28990536 28993368 2832 True 4966 4966 98.277 1 2840 1 chr2D.!!$R3 2839
2 TraesCS2D01G069200 chr2D 28960866 28961734 868 True 1522 1522 98.274 1027 1895 1 chr2D.!!$R1 868
3 TraesCS2D01G069200 chr3D 56222694 56223638 944 False 1639 1639 97.989 1897 2840 1 chr3D.!!$F1 943
4 TraesCS2D01G069200 chr3D 508622428 508623370 942 False 1631 1631 97.879 1898 2840 1 chr3D.!!$F2 942
5 TraesCS2D01G069200 chr1D 219150351 219151295 944 False 1633 1633 97.884 1897 2840 1 chr1D.!!$F1 943
6 TraesCS2D01G069200 chr1D 350420437 350421380 943 True 1633 1633 97.881 1897 2840 1 chr1D.!!$R1 943
7 TraesCS2D01G069200 chr4D 12985116 12986059 943 False 1628 1628 97.775 1897 2840 1 chr4D.!!$F1 943
8 TraesCS2D01G069200 chr7D 501969043 501969987 944 False 1622 1622 97.672 1897 2840 1 chr7D.!!$F1 943
9 TraesCS2D01G069200 chr7D 45795276 45796219 943 True 1616 1616 97.566 1897 2840 1 chr7D.!!$R1 943
10 TraesCS2D01G069200 chr5D 365670300 365671243 943 False 1616 1616 97.564 1897 2840 1 chr5D.!!$F1 943
11 TraesCS2D01G069200 chr3B 800650252 800651285 1033 True 1541 1541 94.010 20 1026 1 chr3B.!!$R1 1006
12 TraesCS2D01G069200 chr3B 410876044 410877071 1027 False 1356 1356 90.874 23 1026 1 chr3B.!!$F1 1003
13 TraesCS2D01G069200 chr3B 802893608 802894628 1020 False 1271 1271 89.525 23 1026 1 chr3B.!!$F2 1003
14 TraesCS2D01G069200 chr7B 706976925 706977945 1020 True 1469 1469 92.940 20 1027 1 chr7B.!!$R1 1007
15 TraesCS2D01G069200 chr2B 69015375 69016395 1020 False 1293 1293 89.913 23 1026 1 chr2B.!!$F2 1003
16 TraesCS2D01G069200 chr2B 46873971 46874784 813 False 1107 1107 91.400 1027 1831 1 chr2B.!!$F1 804
17 TraesCS2D01G069200 chr2B 46800271 46800855 584 True 671 671 87.375 1027 1624 1 chr2B.!!$R2 597
18 TraesCS2D01G069200 chr1A 576246834 576247855 1021 False 1290 1290 89.826 23 1027 1 chr1A.!!$F1 1004
19 TraesCS2D01G069200 chr6B 480826838 480827842 1004 False 1286 1286 89.951 23 1027 1 chr6B.!!$F1 1004
20 TraesCS2D01G069200 chr3A 28719633 28720656 1023 True 1260 1260 89.265 23 1029 1 chr3A.!!$R1 1006
21 TraesCS2D01G069200 chr7A 663802691 663803702 1011 False 965 965 84.453 23 1027 1 chr7A.!!$F1 1004
22 TraesCS2D01G069200 chr4A 17732841 17733728 887 True 885 885 85.363 23 879 1 chr4A.!!$R1 856
23 TraesCS2D01G069200 chrUn 17170364 17170959 595 True 702 702 88.000 1027 1622 1 chrUn.!!$R1 595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
485 573 1.074405 TGGAGCTTGGAGCATTGAAGT 59.926 47.619 2.47 0.0 45.56 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1903 2048 3.635373 AGCGTATATTCCAACTCCGAGAA 59.365 43.478 1.33 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 1.272147 GCCTGGGTCAAGGAAGTCAAT 60.272 52.381 0.00 0.00 40.02 2.57
485 573 1.074405 TGGAGCTTGGAGCATTGAAGT 59.926 47.619 2.47 0.00 45.56 3.01
492 580 1.202915 TGGAGCATTGAAGTTGGAGCA 60.203 47.619 0.00 0.00 0.00 4.26
529 617 1.604378 CTCCCCGTCCATGCTTTCT 59.396 57.895 0.00 0.00 0.00 2.52
904 1009 5.948588 GCCAATTTTCGGCCAAATTTTATT 58.051 33.333 10.32 1.80 44.22 1.40
1903 2048 1.133976 AGGTTGACAGTCTTGCAAGCT 60.134 47.619 21.99 17.99 40.70 3.74
2506 2653 3.531538 TGTTTCTCGATTATGGAGGTGC 58.468 45.455 4.48 0.00 32.34 5.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 8.005388 ACTTACCAAATCTATGAGTAGAGGCTA 58.995 37.037 0.00 0.0 40.16 3.93
485 573 3.153130 TGTTCCATCGAAAATGCTCCAA 58.847 40.909 0.00 0.0 0.00 3.53
492 580 4.010349 GGAGGTCTTGTTCCATCGAAAAT 58.990 43.478 0.00 0.0 33.55 1.82
529 617 4.405358 ACAACAGCTCCAAAAGAAATCCAA 59.595 37.500 0.00 0.0 0.00 3.53
799 902 1.826720 CATAGCAGCCCAACAACCATT 59.173 47.619 0.00 0.0 0.00 3.16
1903 2048 3.635373 AGCGTATATTCCAACTCCGAGAA 59.365 43.478 1.33 0.0 0.00 2.87
2265 2412 4.380531 GAGTCTGACTCAATTTCACACCA 58.619 43.478 28.18 0.0 44.45 4.17
2506 2653 3.304190 CCCTTTACGACGAACCTTTTTGG 60.304 47.826 0.00 0.0 42.93 3.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.