Multiple sequence alignment - TraesCS2D01G059100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G059100 chr2D 100.000 2798 0 0 1 2798 24487173 24489970 0.000000e+00 5168.0
1 TraesCS2D01G059100 chr2A 95.792 2828 69 27 1 2798 26865047 26867854 0.000000e+00 4518.0
2 TraesCS2D01G059100 chr2A 91.642 1352 67 13 982 2323 770397470 770398785 0.000000e+00 1829.0
3 TraesCS2D01G059100 chr2B 94.804 2829 81 35 1 2798 39940666 39943459 0.000000e+00 4349.0
4 TraesCS2D01G059100 chr3A 92.291 1375 53 17 982 2323 588540056 588538702 0.000000e+00 1903.0
5 TraesCS2D01G059100 chr3A 76.974 1672 355 26 436 2093 127856777 127858432 0.000000e+00 928.0
6 TraesCS2D01G059100 chr3A 76.224 1695 370 25 436 2116 127820536 127822211 0.000000e+00 867.0
7 TraesCS2D01G059100 chr7A 92.347 1359 60 14 982 2323 40374656 40375987 0.000000e+00 1893.0
8 TraesCS2D01G059100 chr3B 77.158 1668 359 20 436 2093 173005680 173007335 0.000000e+00 950.0
9 TraesCS2D01G059100 chr3B 75.976 1665 365 27 436 2085 172213956 172212312 0.000000e+00 826.0
10 TraesCS2D01G059100 chr1D 78.003 1532 316 19 436 1958 341027818 341029337 0.000000e+00 942.0
11 TraesCS2D01G059100 chr1D 83.735 498 47 17 1631 2119 480439702 480440174 9.200000e-120 440.0
12 TraesCS2D01G059100 chr1D 79.167 528 104 6 436 960 430228736 430228212 7.370000e-96 361.0
13 TraesCS2D01G059100 chr1D 93.846 65 4 0 339 403 480439046 480439110 6.380000e-17 99.0
14 TraesCS2D01G059100 chr6D 77.177 1665 347 26 436 2085 452125850 452127496 0.000000e+00 939.0
15 TraesCS2D01G059100 chr3D 76.978 1668 362 20 436 2093 121339821 121341476 0.000000e+00 933.0
16 TraesCS2D01G059100 chr3D 76.716 1675 359 27 436 2096 120144632 120142975 0.000000e+00 904.0
17 TraesCS2D01G059100 chr3D 77.533 997 204 17 436 1424 120133729 120132745 1.440000e-162 582.0
18 TraesCS2D01G059100 chr1B 85.885 503 52 11 1600 2094 668799189 668799680 4.130000e-143 518.0
19 TraesCS2D01G059100 chr1B 82.530 498 26 15 957 1440 668765227 668765677 5.660000e-102 381.0
20 TraesCS2D01G059100 chr1B 81.818 484 33 20 965 1440 668798687 668799123 3.430000e-94 355.0
21 TraesCS2D01G059100 chr1B 95.455 132 6 0 1475 1606 668765678 668765809 7.850000e-51 211.0
22 TraesCS2D01G059100 chr1B 80.727 275 21 11 184 449 668764948 668765199 4.760000e-43 185.0
23 TraesCS2D01G059100 chr1B 77.941 136 11 13 9 135 668764811 668764936 1.800000e-07 67.6
24 TraesCS2D01G059100 chr1A 87.006 354 24 6 1088 1430 576784525 576784867 2.030000e-101 379.0
25 TraesCS2D01G059100 chrUn 86.792 159 21 0 1479 1637 230819517 230819359 7.960000e-41 178.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G059100 chr2D 24487173 24489970 2797 False 5168.00 5168 100.00000 1 2798 1 chr2D.!!$F1 2797
1 TraesCS2D01G059100 chr2A 26865047 26867854 2807 False 4518.00 4518 95.79200 1 2798 1 chr2A.!!$F1 2797
2 TraesCS2D01G059100 chr2A 770397470 770398785 1315 False 1829.00 1829 91.64200 982 2323 1 chr2A.!!$F2 1341
3 TraesCS2D01G059100 chr2B 39940666 39943459 2793 False 4349.00 4349 94.80400 1 2798 1 chr2B.!!$F1 2797
4 TraesCS2D01G059100 chr3A 588538702 588540056 1354 True 1903.00 1903 92.29100 982 2323 1 chr3A.!!$R1 1341
5 TraesCS2D01G059100 chr3A 127856777 127858432 1655 False 928.00 928 76.97400 436 2093 1 chr3A.!!$F2 1657
6 TraesCS2D01G059100 chr3A 127820536 127822211 1675 False 867.00 867 76.22400 436 2116 1 chr3A.!!$F1 1680
7 TraesCS2D01G059100 chr7A 40374656 40375987 1331 False 1893.00 1893 92.34700 982 2323 1 chr7A.!!$F1 1341
8 TraesCS2D01G059100 chr3B 173005680 173007335 1655 False 950.00 950 77.15800 436 2093 1 chr3B.!!$F1 1657
9 TraesCS2D01G059100 chr3B 172212312 172213956 1644 True 826.00 826 75.97600 436 2085 1 chr3B.!!$R1 1649
10 TraesCS2D01G059100 chr1D 341027818 341029337 1519 False 942.00 942 78.00300 436 1958 1 chr1D.!!$F1 1522
11 TraesCS2D01G059100 chr1D 430228212 430228736 524 True 361.00 361 79.16700 436 960 1 chr1D.!!$R1 524
12 TraesCS2D01G059100 chr1D 480439046 480440174 1128 False 269.50 440 88.79050 339 2119 2 chr1D.!!$F2 1780
13 TraesCS2D01G059100 chr6D 452125850 452127496 1646 False 939.00 939 77.17700 436 2085 1 chr6D.!!$F1 1649
14 TraesCS2D01G059100 chr3D 121339821 121341476 1655 False 933.00 933 76.97800 436 2093 1 chr3D.!!$F1 1657
15 TraesCS2D01G059100 chr3D 120142975 120144632 1657 True 904.00 904 76.71600 436 2096 1 chr3D.!!$R2 1660
16 TraesCS2D01G059100 chr3D 120132745 120133729 984 True 582.00 582 77.53300 436 1424 1 chr3D.!!$R1 988
17 TraesCS2D01G059100 chr1B 668798687 668799680 993 False 436.50 518 83.85150 965 2094 2 chr1B.!!$F2 1129
18 TraesCS2D01G059100 chr1B 668764811 668765809 998 False 211.15 381 84.16325 9 1606 4 chr1B.!!$F1 1597

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
72 79 1.136336 CCGTAGCAAAGTTCTCGCAAC 60.136 52.381 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2194 2331 7.231115 TCCATTCTTGAGTTGTTGATTGATTCA 59.769 33.333 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 44 3.450817 TCATCCGAGATAACTTGCCTCAA 59.549 43.478 0.00 0.00 0.00 3.02
42 45 4.101585 TCATCCGAGATAACTTGCCTCAAT 59.898 41.667 0.00 0.00 0.00 2.57
43 46 4.060038 TCCGAGATAACTTGCCTCAATC 57.940 45.455 0.00 0.00 0.00 2.67
44 47 3.450817 TCCGAGATAACTTGCCTCAATCA 59.549 43.478 0.00 0.00 0.00 2.57
45 48 3.557595 CCGAGATAACTTGCCTCAATCAC 59.442 47.826 0.00 0.00 0.00 3.06
72 79 1.136336 CCGTAGCAAAGTTCTCGCAAC 60.136 52.381 0.00 0.00 0.00 4.17
82 91 6.307155 CAAAGTTCTCGCAACTATGTAAAGG 58.693 40.000 0.56 0.00 0.00 3.11
135 144 9.859427 TCTGCAAATTACAAATCCTAGATTTTG 57.141 29.630 12.91 12.91 38.49 2.44
1958 2075 2.427245 CCTCGTCCTCCCGCTTGAT 61.427 63.158 0.00 0.00 0.00 2.57
2194 2331 4.199432 AGAACAGATCAAGAAGACGCAT 57.801 40.909 0.00 0.00 0.00 4.73
2208 2345 5.181811 AGAAGACGCATGAATCAATCAACAA 59.818 36.000 0.00 0.00 42.54 2.83
2218 2355 8.860128 CATGAATCAATCAACAACTCAAGAATG 58.140 33.333 0.00 0.00 42.54 2.67
2442 2597 4.430765 CGTCCTTGGCGGCGTAGT 62.431 66.667 9.37 0.00 0.00 2.73
2642 2797 3.987594 GTCCTTCTTGGGCTCCATT 57.012 52.632 0.00 0.00 37.49 3.16
2644 2799 0.332632 TCCTTCTTGGGCTCCATTGG 59.667 55.000 0.00 0.00 36.20 3.16
2645 2800 1.325476 CCTTCTTGGGCTCCATTGGC 61.325 60.000 0.00 0.00 31.53 4.52
2646 2801 1.660560 CTTCTTGGGCTCCATTGGCG 61.661 60.000 0.00 0.00 31.53 5.69
2680 2855 0.532573 TCGATCAAGCTTCTTCGGCT 59.467 50.000 21.19 0.00 42.31 5.52
2687 2862 0.177604 AGCTTCTTCGGCTGATCTGG 59.822 55.000 0.00 0.00 38.73 3.86
2689 2864 1.649664 CTTCTTCGGCTGATCTGGTG 58.350 55.000 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 4.213906 TCTCGGATGAACACGCGTATTATA 59.786 41.667 13.44 0.00 0.00 0.98
6 7 3.004002 TCTCGGATGAACACGCGTATTAT 59.996 43.478 13.44 6.29 0.00 1.28
10 11 0.736636 ATCTCGGATGAACACGCGTA 59.263 50.000 13.44 0.00 0.00 4.42
41 44 1.890876 TTGCTACGGCTTGTTGTGAT 58.109 45.000 0.00 0.00 39.59 3.06
42 45 1.601903 CTTTGCTACGGCTTGTTGTGA 59.398 47.619 0.00 0.00 39.59 3.58
43 46 1.333619 ACTTTGCTACGGCTTGTTGTG 59.666 47.619 0.00 0.00 39.59 3.33
44 47 1.675552 ACTTTGCTACGGCTTGTTGT 58.324 45.000 0.00 0.00 39.59 3.32
45 48 2.290641 AGAACTTTGCTACGGCTTGTTG 59.709 45.455 0.00 0.00 39.59 3.33
72 79 6.678900 GCATGGTTCTGCTTTCCTTTACATAG 60.679 42.308 0.00 0.00 39.12 2.23
135 144 1.661112 GATTCGCTGTACTGAGCCAAC 59.339 52.381 3.61 0.00 35.36 3.77
2194 2331 7.231115 TCCATTCTTGAGTTGTTGATTGATTCA 59.769 33.333 0.00 0.00 0.00 2.57
2208 2345 2.351835 CGTCGTCAGTCCATTCTTGAGT 60.352 50.000 0.00 0.00 0.00 3.41
2218 2355 2.726066 CGTAAGTAACCGTCGTCAGTCC 60.726 54.545 0.00 0.00 0.00 3.85
2564 2719 4.293648 CTGGTGGTGGACGACGCA 62.294 66.667 0.00 0.00 0.00 5.24
2674 2849 1.612146 TCCCACCAGATCAGCCGAA 60.612 57.895 0.00 0.00 0.00 4.30
2680 2855 1.697284 CTCGATCTCCCACCAGATCA 58.303 55.000 10.33 0.00 46.51 2.92
2687 2862 1.357334 GACTCGCTCGATCTCCCAC 59.643 63.158 0.00 0.00 0.00 4.61
2689 2864 2.634777 CGACTCGCTCGATCTCCC 59.365 66.667 0.00 0.00 46.14 4.30
2770 2951 4.096081 GGTTCACGCTCGCTATATATACCT 59.904 45.833 0.00 0.00 0.00 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.