Multiple sequence alignment - TraesCS2D01G049100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G049100 chr2D 100.000 2351 0 0 1 2351 17983478 17985828 0 4342
1 TraesCS2D01G049100 chr2D 97.554 2371 36 5 1 2350 637309599 637307230 0 4037
2 TraesCS2D01G049100 chr2D 97.218 2372 38 9 1 2350 306151993 306154358 0 3989
3 TraesCS2D01G049100 chrUn 98.144 2371 22 5 1 2350 257943218 257945587 0 4115
4 TraesCS2D01G049100 chrUn 97.891 2371 23 6 1 2350 233526162 233523798 0 4076
5 TraesCS2D01G049100 chrUn 95.915 612 7 3 1757 2350 369795034 369795645 0 976
6 TraesCS2D01G049100 chr4D 97.680 2371 34 4 1 2350 123688067 123690437 0 4054
7 TraesCS2D01G049100 chr4D 96.347 2354 70 10 1 2350 241052813 241055154 0 3856
8 TraesCS2D01G049100 chr7D 96.879 2371 50 7 1 2350 307088603 307090970 0 3947
9 TraesCS2D01G049100 chr6D 96.838 2372 52 6 1 2350 283186518 283188888 0 3943
10 TraesCS2D01G049100 chr7A 96.837 2371 44 7 1 2350 211239019 211236659 0 3934
11 TraesCS2D01G049100 chr7A 97.267 2305 37 5 67 2350 60097027 60094728 0 3884
12 TraesCS2D01G049100 chr4B 96.626 2371 52 7 1 2350 495538668 495536305 0 3910
13 TraesCS2D01G049100 chr6B 97.310 2305 36 5 67 2350 128890812 128888513 0 3890
14 TraesCS2D01G049100 chr7B 97.181 2306 38 6 67 2350 716796668 716794368 0 3873
15 TraesCS2D01G049100 chr7B 97.572 2265 28 6 107 2350 698127721 698125463 0 3853


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G049100 chr2D 17983478 17985828 2350 False 4342 4342 100.000 1 2351 1 chr2D.!!$F1 2350
1 TraesCS2D01G049100 chr2D 637307230 637309599 2369 True 4037 4037 97.554 1 2350 1 chr2D.!!$R1 2349
2 TraesCS2D01G049100 chr2D 306151993 306154358 2365 False 3989 3989 97.218 1 2350 1 chr2D.!!$F2 2349
3 TraesCS2D01G049100 chrUn 257943218 257945587 2369 False 4115 4115 98.144 1 2350 1 chrUn.!!$F1 2349
4 TraesCS2D01G049100 chrUn 233523798 233526162 2364 True 4076 4076 97.891 1 2350 1 chrUn.!!$R1 2349
5 TraesCS2D01G049100 chrUn 369795034 369795645 611 False 976 976 95.915 1757 2350 1 chrUn.!!$F2 593
6 TraesCS2D01G049100 chr4D 123688067 123690437 2370 False 4054 4054 97.680 1 2350 1 chr4D.!!$F1 2349
7 TraesCS2D01G049100 chr4D 241052813 241055154 2341 False 3856 3856 96.347 1 2350 1 chr4D.!!$F2 2349
8 TraesCS2D01G049100 chr7D 307088603 307090970 2367 False 3947 3947 96.879 1 2350 1 chr7D.!!$F1 2349
9 TraesCS2D01G049100 chr6D 283186518 283188888 2370 False 3943 3943 96.838 1 2350 1 chr6D.!!$F1 2349
10 TraesCS2D01G049100 chr7A 211236659 211239019 2360 True 3934 3934 96.837 1 2350 1 chr7A.!!$R2 2349
11 TraesCS2D01G049100 chr7A 60094728 60097027 2299 True 3884 3884 97.267 67 2350 1 chr7A.!!$R1 2283
12 TraesCS2D01G049100 chr4B 495536305 495538668 2363 True 3910 3910 96.626 1 2350 1 chr4B.!!$R1 2349
13 TraesCS2D01G049100 chr6B 128888513 128890812 2299 True 3890 3890 97.310 67 2350 1 chr6B.!!$R1 2283
14 TraesCS2D01G049100 chr7B 716794368 716796668 2300 True 3873 3873 97.181 67 2350 1 chr7B.!!$R2 2283
15 TraesCS2D01G049100 chr7B 698125463 698127721 2258 True 3853 3853 97.572 107 2350 1 chr7B.!!$R1 2243

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
351 353 2.710902 CCCTCGCATCTCGGTCACA 61.711 63.158 0.0 0.0 39.05 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 2150 1.033574 CTCTTCCTCGGTAAGCGGAT 58.966 55.0 0.0 0.0 33.07 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 282 8.526147 AGCTTATTTATGATTTTGTGCTGAACT 58.474 29.630 0.00 0.00 0.00 3.01
351 353 2.710902 CCCTCGCATCTCGGTCACA 61.711 63.158 0.00 0.00 39.05 3.58
1133 1140 4.163078 AGGTATCAGTGGGAACATCAAGAG 59.837 45.833 0.00 0.00 46.14 2.85
1287 1294 5.059161 GGAATTCGTCATCAAGATGGATCA 58.941 41.667 9.96 0.00 39.24 2.92
1610 1617 0.937699 CTTCGTCCGTCAAGCGACAA 60.938 55.000 0.00 0.00 42.74 3.18
1870 1877 2.044551 CCCTTCCTGCCTGCTTCC 60.045 66.667 0.00 0.00 0.00 3.46
1871 1878 2.610519 CCCTTCCTGCCTGCTTCCT 61.611 63.158 0.00 0.00 0.00 3.36
1983 2008 5.530915 CCAGCCGATCCTAACATAATTTTGA 59.469 40.000 2.69 0.00 0.00 2.69
2011 2036 2.613691 GGACGACGAAGCCTCAAAATA 58.386 47.619 0.00 0.00 0.00 1.40
2125 2150 0.325296 ATACTCCCCAGCTTCCACGA 60.325 55.000 0.00 0.00 0.00 4.35
2232 2257 1.589196 GAGGATGTGCTCGTACGGC 60.589 63.158 16.52 17.49 0.00 5.68
2350 2375 5.163301 TGGTCCCTTATGAAGTCTCTATTGC 60.163 44.000 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 282 5.131784 ACCACCTATTTGTTCGTTTACCAA 58.868 37.500 0.00 0.00 0.00 3.67
650 657 6.094603 CAGAAATAGCATAGTCCAAGCAAACT 59.905 38.462 0.00 0.00 0.00 2.66
1133 1140 9.400638 CGATCTGATACTTAGTTAACTCATTCC 57.599 37.037 12.39 0.00 0.00 3.01
1406 1413 2.521105 AGGAGCAAGAAAACGTACGT 57.479 45.000 16.72 16.72 0.00 3.57
1408 1415 2.876550 ACCAAGGAGCAAGAAAACGTAC 59.123 45.455 0.00 0.00 0.00 3.67
1637 1644 5.326069 AGACAACTACTACCAGTCATGAGT 58.674 41.667 0.00 0.00 0.00 3.41
1870 1877 6.367149 TCAGACTGAAATTGATGTCGAAGAAG 59.633 38.462 1.64 0.00 39.69 2.85
1871 1878 6.223120 TCAGACTGAAATTGATGTCGAAGAA 58.777 36.000 1.64 0.00 39.69 2.52
1921 1946 7.095695 TCCGAAAAGAAAACAGAGACAAAAT 57.904 32.000 0.00 0.00 0.00 1.82
1983 2008 2.987547 TTCGTCGTCCGGCTCCTT 60.988 61.111 0.00 0.00 37.11 3.36
2125 2150 1.033574 CTCTTCCTCGGTAAGCGGAT 58.966 55.000 0.00 0.00 33.07 4.18
2232 2257 7.757173 CACGAGAATATCATACCCAACTATGAG 59.243 40.741 0.00 0.00 36.73 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.