Multiple sequence alignment - TraesCS2D01G048400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G048400 chr2D 100.000 2318 0 0 1 2318 17640305 17637988 0.000000e+00 4281.0
1 TraesCS2D01G048400 chr2D 98.965 2318 24 0 1 2318 17612934 17610617 0.000000e+00 4148.0
2 TraesCS2D01G048400 chr2D 83.388 1529 209 28 4 1500 17775303 17773788 0.000000e+00 1375.0
3 TraesCS2D01G048400 chr2A 97.243 2321 60 4 1 2318 19035145 19032826 0.000000e+00 3928.0
4 TraesCS2D01G048400 chr2A 82.680 791 99 18 833 1606 19054064 19053295 0.000000e+00 667.0
5 TraesCS2D01G048400 chr2B 95.011 2325 103 11 1 2318 29549174 29551492 0.000000e+00 3639.0
6 TraesCS2D01G048400 chr2B 83.929 1624 214 34 4 1598 29263053 29264658 0.000000e+00 1509.0
7 TraesCS2D01G048400 chr2B 83.744 1624 217 34 4 1598 29318290 29319895 0.000000e+00 1493.0
8 TraesCS2D01G048400 chr2B 83.692 1625 216 36 4 1598 29349409 29351014 0.000000e+00 1487.0
9 TraesCS2D01G048400 chr2B 84.548 1029 138 15 300 1317 29218513 29219531 0.000000e+00 1000.0
10 TraesCS2D01G048400 chr2B 86.957 276 32 3 4 279 29218183 29218454 8.050000e-80 307.0
11 TraesCS2D01G048400 chr2B 79.762 252 30 7 1355 1595 29219539 29219780 1.840000e-36 163.0
12 TraesCS2D01G048400 chr3B 94.969 1451 67 4 189 1638 765017784 765019229 0.000000e+00 2270.0
13 TraesCS2D01G048400 chr3B 93.521 355 21 1 1630 1984 765019255 765019607 5.670000e-146 527.0
14 TraesCS2D01G048400 chr3B 89.362 47 4 1 1942 1988 610750382 610750337 8.950000e-05 58.4
15 TraesCS2D01G048400 chr7B 81.789 615 87 9 1006 1607 745128183 745128785 2.070000e-135 492.0
16 TraesCS2D01G048400 chr1B 81.463 615 88 9 1006 1607 651061658 651061057 4.480000e-132 481.0
17 TraesCS2D01G048400 chr5D 86.916 107 12 2 1947 2052 330886235 330886130 4.050000e-23 119.0
18 TraesCS2D01G048400 chr3D 89.362 47 4 1 1942 1988 460498413 460498368 8.950000e-05 58.4
19 TraesCS2D01G048400 chr3A 89.362 47 4 1 1942 1988 602918694 602918649 8.950000e-05 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G048400 chr2D 17637988 17640305 2317 True 4281.0 4281 100.000000 1 2318 1 chr2D.!!$R2 2317
1 TraesCS2D01G048400 chr2D 17610617 17612934 2317 True 4148.0 4148 98.965000 1 2318 1 chr2D.!!$R1 2317
2 TraesCS2D01G048400 chr2D 17773788 17775303 1515 True 1375.0 1375 83.388000 4 1500 1 chr2D.!!$R3 1496
3 TraesCS2D01G048400 chr2A 19032826 19035145 2319 True 3928.0 3928 97.243000 1 2318 1 chr2A.!!$R1 2317
4 TraesCS2D01G048400 chr2A 19053295 19054064 769 True 667.0 667 82.680000 833 1606 1 chr2A.!!$R2 773
5 TraesCS2D01G048400 chr2B 29549174 29551492 2318 False 3639.0 3639 95.011000 1 2318 1 chr2B.!!$F4 2317
6 TraesCS2D01G048400 chr2B 29263053 29264658 1605 False 1509.0 1509 83.929000 4 1598 1 chr2B.!!$F1 1594
7 TraesCS2D01G048400 chr2B 29318290 29319895 1605 False 1493.0 1493 83.744000 4 1598 1 chr2B.!!$F2 1594
8 TraesCS2D01G048400 chr2B 29349409 29351014 1605 False 1487.0 1487 83.692000 4 1598 1 chr2B.!!$F3 1594
9 TraesCS2D01G048400 chr2B 29218183 29219780 1597 False 490.0 1000 83.755667 4 1595 3 chr2B.!!$F5 1591
10 TraesCS2D01G048400 chr3B 765017784 765019607 1823 False 1398.5 2270 94.245000 189 1984 2 chr3B.!!$F1 1795
11 TraesCS2D01G048400 chr7B 745128183 745128785 602 False 492.0 492 81.789000 1006 1607 1 chr7B.!!$F1 601
12 TraesCS2D01G048400 chr1B 651061057 651061658 601 True 481.0 481 81.463000 1006 1607 1 chr1B.!!$R1 601

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
100 102 3.582164 ACCTTGAGCCTTCCTCCTATAG 58.418 50.000 0.0 0.0 39.98 1.31 F
518 559 8.633075 AGGTTCAATATTTTTCATTGTATGCG 57.367 30.769 0.0 0.0 35.36 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1056 1110 1.071699 GCAACACCCTCCAAGACACTA 59.928 52.381 0.00 0.0 0.0 2.74 R
2057 2166 9.682465 ACTGTACATGTAGTCTAAGATAACTGA 57.318 33.333 5.62 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 102 3.582164 ACCTTGAGCCTTCCTCCTATAG 58.418 50.000 0.00 0.0 39.98 1.31
518 559 8.633075 AGGTTCAATATTTTTCATTGTATGCG 57.367 30.769 0.00 0.0 35.36 4.73
1056 1110 5.363292 TGCCCTTGCAATTGTGTTATCATAT 59.637 36.000 7.40 0.0 46.66 1.78
1351 1409 0.622665 AGAGGACCATGGGCAGAAAG 59.377 55.000 22.13 0.0 0.00 2.62
2308 2422 2.358898 TGCTCAAACTTTGAAGGTGCTC 59.641 45.455 5.72 0.0 39.58 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 102 4.940463 TCGGTGCAGTTAACATACCTATC 58.060 43.478 18.00 0.0 0.0 2.08
518 559 7.369803 TCAGAAGCAGTAGATCAAACATTTC 57.630 36.000 0.00 0.0 0.0 2.17
1056 1110 1.071699 GCAACACCCTCCAAGACACTA 59.928 52.381 0.00 0.0 0.0 2.74
2057 2166 9.682465 ACTGTACATGTAGTCTAAGATAACTGA 57.318 33.333 5.62 0.0 0.0 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.