Multiple sequence alignment - TraesCS2D01G048300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G048300 chr2D 100.000 3774 0 0 1 3774 17635169 17631396 0.000000e+00 6970
1 TraesCS2D01G048300 chr2D 98.812 3788 29 4 1 3774 17609430 17605645 0.000000e+00 6732
2 TraesCS2D01G048300 chr2D 77.399 323 62 10 1784 2104 16246140 16246453 8.330000e-42 182
3 TraesCS2D01G048300 chr2D 83.333 126 13 5 1363 1481 234759883 234759759 3.990000e-20 110
4 TraesCS2D01G048300 chr2D 81.818 132 16 5 1354 1478 274856545 274856415 1.850000e-18 104
5 TraesCS2D01G048300 chr2A 97.693 3597 70 8 180 3774 19031447 19027862 0.000000e+00 6170
6 TraesCS2D01G048300 chr2A 97.546 163 4 0 10 172 19031651 19031489 2.870000e-71 279
7 TraesCS2D01G048300 chr2B 94.725 3147 122 17 1 3138 29552674 29555785 0.000000e+00 4852
8 TraesCS2D01G048300 chr2B 96.219 529 18 2 3247 3774 29555805 29556332 0.000000e+00 865
9 TraesCS2D01G048300 chr2B 77.716 718 106 36 2383 3087 29263988 29264664 1.270000e-104 390
10 TraesCS2D01G048300 chr2B 77.716 718 106 36 2383 3087 29319225 29319901 1.270000e-104 390
11 TraesCS2D01G048300 chr2B 77.577 718 108 33 2383 3087 29350343 29351020 5.910000e-103 385
12 TraesCS2D01G048300 chr1D 79.412 306 52 9 1803 2104 110589309 110589011 4.940000e-49 206
13 TraesCS2D01G048300 chr7A 78.413 315 61 7 1786 2098 38518617 38518926 8.270000e-47 198
14 TraesCS2D01G048300 chr7A 77.603 317 64 6 1789 2103 38515928 38516239 6.440000e-43 185
15 TraesCS2D01G048300 chr1A 78.125 320 58 11 1789 2104 351866401 351866090 3.850000e-45 193
16 TraesCS2D01G048300 chr1A 77.160 324 66 7 1782 2104 6207600 6207284 8.330000e-42 182
17 TraesCS2D01G048300 chr6D 83.660 153 17 3 1329 1474 392273075 392273226 1.830000e-28 137
18 TraesCS2D01G048300 chr3D 83.803 142 14 5 1344 1478 609076881 609076742 3.960000e-25 126
19 TraesCS2D01G048300 chr6B 83.824 136 14 3 1348 1476 277616170 277616304 5.120000e-24 122
20 TraesCS2D01G048300 chr5A 81.046 153 21 5 1329 1474 277726087 277725936 8.570000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G048300 chr2D 17631396 17635169 3773 True 6970.0 6970 100.0000 1 3774 1 chr2D.!!$R2 3773
1 TraesCS2D01G048300 chr2D 17605645 17609430 3785 True 6732.0 6732 98.8120 1 3774 1 chr2D.!!$R1 3773
2 TraesCS2D01G048300 chr2A 19027862 19031651 3789 True 3224.5 6170 97.6195 10 3774 2 chr2A.!!$R1 3764
3 TraesCS2D01G048300 chr2B 29552674 29556332 3658 False 2858.5 4852 95.4720 1 3774 2 chr2B.!!$F4 3773
4 TraesCS2D01G048300 chr2B 29263988 29264664 676 False 390.0 390 77.7160 2383 3087 1 chr2B.!!$F1 704
5 TraesCS2D01G048300 chr2B 29319225 29319901 676 False 390.0 390 77.7160 2383 3087 1 chr2B.!!$F2 704
6 TraesCS2D01G048300 chr2B 29350343 29351020 677 False 385.0 385 77.5770 2383 3087 1 chr2B.!!$F3 704

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
887 925 1.741032 TTGCGCATGCTCGACATCA 60.741 52.632 12.75 0.0 43.34 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3496 3547 0.443869 GCTTGTATGTGCACGACCAG 59.556 55.0 13.13 14.21 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 186 2.760092 GGATGCAACAGAGAGAGAGAGT 59.240 50.000 0.00 0.00 0.00 3.24
393 431 7.432148 AGAGATTATGGTGTACAATGGTGTA 57.568 36.000 0.00 0.00 39.30 2.90
542 580 6.599356 ACAAAACCTTTACCTTTTGAGTGT 57.401 33.333 9.28 0.00 38.95 3.55
795 833 7.984050 TGTTGTTATATTGGCCACAAATTATGG 59.016 33.333 3.88 4.58 40.55 2.74
887 925 1.741032 TTGCGCATGCTCGACATCA 60.741 52.632 12.75 0.00 43.34 3.07
1035 1074 9.019656 ACATGTAAGTTTGTATGCTATTTTCCA 57.980 29.630 0.00 0.00 0.00 3.53
1579 1620 6.214191 TGTCACAGGTTAAAAATGCTTGAA 57.786 33.333 0.00 0.00 0.00 2.69
2600 2644 5.476752 GCAGAAAGTATCCTTTACTGCAG 57.523 43.478 13.48 13.48 46.73 4.41
3107 3156 9.978336 AGAACTACTTTCCAGTACTAGTAGAAT 57.022 33.333 26.55 18.24 41.53 2.40
3496 3547 0.798159 TGCATGTCATCAGCGTTGTC 59.202 50.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 186 4.871822 TCTCTCTCTCTCTCTCTCTCTCA 58.128 47.826 0.00 0.00 0.00 3.27
321 359 8.883731 CCACAAACCAAAACATAATTTAACACA 58.116 29.630 0.00 0.00 0.00 3.72
393 431 4.020573 TGTCGTCCTTGGTCATAGATGTTT 60.021 41.667 0.00 0.00 0.00 2.83
542 580 4.814234 CACCTATAAGCACCTATTTTGCGA 59.186 41.667 0.00 0.00 45.15 5.10
795 833 2.221981 CGACTGAAGCTGAAGTGGAAAC 59.778 50.000 6.30 0.00 0.00 2.78
1521 1562 4.207891 AGGTGCTAGTGGAAATACTGTG 57.792 45.455 0.00 0.00 32.19 3.66
1579 1620 7.093377 TGGTACATATTACTCCAAAACGGTAGT 60.093 37.037 0.00 0.00 35.57 2.73
3496 3547 0.443869 GCTTGTATGTGCACGACCAG 59.556 55.000 13.13 14.21 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.