Multiple sequence alignment - TraesCS2D01G048100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G048100 chr2D 100.000 2695 0 0 1 2695 17613106 17610412 0.000000e+00 4977.0
1 TraesCS2D01G048100 chr2D 98.961 2695 28 0 1 2695 17640477 17637783 0.000000e+00 4822.0
2 TraesCS2D01G048100 chr2D 83.920 1704 229 28 1 1672 17775478 17773788 0.000000e+00 1587.0
3 TraesCS2D01G048100 chr2A 97.291 2695 67 5 4 2695 19035314 19032623 0.000000e+00 4567.0
4 TraesCS2D01G048100 chr2A 83.269 783 93 18 1005 1770 19054064 19053303 0.000000e+00 686.0
5 TraesCS2D01G048100 chr2A 79.853 273 37 14 2417 2672 24210416 24210145 1.650000e-42 183.0
6 TraesCS2D01G048100 chr2A 76.235 324 54 13 2364 2668 772665483 772665802 1.670000e-32 150.0
7 TraesCS2D01G048100 chr2B 95.300 2702 114 11 1 2695 29549002 29551697 0.000000e+00 4274.0
8 TraesCS2D01G048100 chr2B 84.611 1800 228 34 1 1770 29262878 29264658 0.000000e+00 1744.0
9 TraesCS2D01G048100 chr2B 84.389 1800 232 34 1 1770 29318115 29319895 0.000000e+00 1722.0
10 TraesCS2D01G048100 chr2B 84.398 1801 230 36 1 1770 29349234 29351014 0.000000e+00 1722.0
11 TraesCS2D01G048100 chr2B 84.645 1029 137 15 472 1489 29218513 29219531 0.000000e+00 1005.0
12 TraesCS2D01G048100 chr2B 87.755 441 49 4 11 451 29218019 29218454 6.660000e-141 510.0
13 TraesCS2D01G048100 chr3B 94.900 1451 68 4 361 1810 765017784 765019229 0.000000e+00 2265.0
14 TraesCS2D01G048100 chr3B 93.521 355 21 1 1802 2156 765019255 765019607 6.610000e-146 527.0
15 TraesCS2D01G048100 chr3B 89.362 47 4 1 2114 2160 610750382 610750337 1.040000e-04 58.4
16 TraesCS2D01G048100 chr3D 84.774 243 24 4 2438 2669 11779940 11780180 5.800000e-57 231.0
17 TraesCS2D01G048100 chr3D 89.362 47 4 1 2114 2160 460498413 460498368 1.040000e-04 58.4
18 TraesCS2D01G048100 chr3A 83.871 248 25 7 2449 2682 25240757 25240511 3.490000e-54 222.0
19 TraesCS2D01G048100 chr3A 89.362 47 4 1 2114 2160 602918694 602918649 1.040000e-04 58.4
20 TraesCS2D01G048100 chr6D 82.759 261 31 12 2394 2648 455832691 455832943 1.260000e-53 220.0
21 TraesCS2D01G048100 chr5D 81.752 274 40 9 2399 2670 2788205 2788470 1.260000e-53 220.0
22 TraesCS2D01G048100 chr5D 86.916 107 12 2 2119 2224 330886235 330886130 4.710000e-23 119.0
23 TraesCS2D01G048100 chr6B 82.684 231 25 7 2429 2648 693072435 693072661 9.850000e-45 191.0
24 TraesCS2D01G048100 chrUn 80.556 252 34 6 2429 2668 49171904 49172152 2.130000e-41 180.0
25 TraesCS2D01G048100 chrUn 80.556 252 34 6 2429 2668 252588774 252589022 2.130000e-41 180.0
26 TraesCS2D01G048100 chr4A 79.323 266 29 15 2424 2682 645949779 645949533 2.150000e-36 163.0
27 TraesCS2D01G048100 chr1B 79.638 221 29 12 2434 2641 657317924 657317707 7.780000e-31 145.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G048100 chr2D 17610412 17613106 2694 True 4977.0 4977 100.0000 1 2695 1 chr2D.!!$R1 2694
1 TraesCS2D01G048100 chr2D 17637783 17640477 2694 True 4822.0 4822 98.9610 1 2695 1 chr2D.!!$R2 2694
2 TraesCS2D01G048100 chr2D 17773788 17775478 1690 True 1587.0 1587 83.9200 1 1672 1 chr2D.!!$R3 1671
3 TraesCS2D01G048100 chr2A 19032623 19035314 2691 True 4567.0 4567 97.2910 4 2695 1 chr2A.!!$R1 2691
4 TraesCS2D01G048100 chr2A 19053303 19054064 761 True 686.0 686 83.2690 1005 1770 1 chr2A.!!$R2 765
5 TraesCS2D01G048100 chr2B 29549002 29551697 2695 False 4274.0 4274 95.3000 1 2695 1 chr2B.!!$F4 2694
6 TraesCS2D01G048100 chr2B 29262878 29264658 1780 False 1744.0 1744 84.6110 1 1770 1 chr2B.!!$F1 1769
7 TraesCS2D01G048100 chr2B 29318115 29319895 1780 False 1722.0 1722 84.3890 1 1770 1 chr2B.!!$F2 1769
8 TraesCS2D01G048100 chr2B 29349234 29351014 1780 False 1722.0 1722 84.3980 1 1770 1 chr2B.!!$F3 1769
9 TraesCS2D01G048100 chr2B 29218019 29219531 1512 False 757.5 1005 86.2000 11 1489 2 chr2B.!!$F5 1478
10 TraesCS2D01G048100 chr3B 765017784 765019607 1823 False 1396.0 2265 94.2105 361 2156 2 chr3B.!!$F1 1795

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
193 194 6.469139 TTACGATTCATGTAAAAGTTGCGA 57.531 33.333 0.0 0.0 0.0 5.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1711 1789 2.684001 TAGTTGCCGTTACCATGGAG 57.316 50.0 21.47 6.53 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 6.469139 TTACGATTCATGTAAAAGTTGCGA 57.531 33.333 0.0 0.0 0.00 5.10
1577 1636 6.985188 TTGGTGATTTCTACACTAAGATGC 57.015 37.500 0.0 0.0 34.75 3.91
1711 1789 3.119388 TGCAGAATAAACCAAGCTCATGC 60.119 43.478 0.0 0.0 40.05 4.06
1772 1850 9.746711 CGATTCTTTGTCATTCTACAAGTAAAG 57.253 33.333 0.0 0.0 40.29 1.85
1831 1943 4.390264 AGTAGTTGAAGCCTTTTCTGTCC 58.610 43.478 0.0 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 1.072331 GGATAATGGATGTCCGGCACT 59.928 52.381 0.00 0.00 39.43 4.40
1711 1789 2.684001 TAGTTGCCGTTACCATGGAG 57.316 50.000 21.47 6.53 0.00 3.86
1772 1850 8.776680 TTTGTCTAATAGTTTTCGAAAGTTGC 57.223 30.769 10.98 3.58 0.00 4.17
2447 2567 5.940192 AAGTTTGAGCATATTTGACGTCA 57.060 34.783 15.76 15.76 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.