Multiple sequence alignment - TraesCS2D01G048000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G048000 chr2D 100.000 3775 0 0 1 3775 17609418 17605644 0.000000e+00 6972
1 TraesCS2D01G048000 chr2D 98.809 3777 29 4 1 3775 17635157 17631395 0.000000e+00 6711
2 TraesCS2D01G048000 chr2D 77.399 323 62 10 1785 2105 16246140 16246453 8.330000e-42 182
3 TraesCS2D01G048000 chr2D 83.333 126 13 5 1364 1482 234759883 234759759 3.990000e-20 110
4 TraesCS2D01G048000 chr2D 81.203 133 16 5 1354 1479 274856545 274856415 8.630000e-17 99
5 TraesCS2D01G048000 chr2A 96.894 3799 83 9 1 3775 19031648 19027861 0.000000e+00 6329
6 TraesCS2D01G048000 chr2B 94.566 3147 114 16 1 3137 29552686 29555785 0.000000e+00 4811
7 TraesCS2D01G048000 chr2B 96.226 530 19 1 3246 3775 29555805 29556333 0.000000e+00 867
8 TraesCS2D01G048000 chr2B 77.855 718 105 36 2384 3088 29263988 29264664 2.730000e-106 396
9 TraesCS2D01G048000 chr2B 77.855 718 105 36 2384 3088 29319225 29319901 2.730000e-106 396
10 TraesCS2D01G048000 chr2B 77.716 718 107 33 2384 3088 29350343 29351020 1.270000e-104 390
11 TraesCS2D01G048000 chr1D 79.412 306 52 9 1804 2105 110589309 110589011 4.940000e-49 206
12 TraesCS2D01G048000 chr7A 78.413 315 61 7 1787 2099 38518617 38518926 8.270000e-47 198
13 TraesCS2D01G048000 chr7A 77.603 317 64 6 1790 2104 38515928 38516239 6.440000e-43 185
14 TraesCS2D01G048000 chr1A 78.125 320 58 11 1790 2105 351866401 351866090 3.850000e-45 193
15 TraesCS2D01G048000 chr1A 77.160 324 66 7 1783 2105 6207600 6207284 8.330000e-42 182
16 TraesCS2D01G048000 chr6D 83.117 154 17 3 1329 1475 392273075 392273226 8.510000e-27 132
17 TraesCS2D01G048000 chr3D 83.217 143 14 5 1344 1479 609076881 609076742 5.120000e-24 122
18 TraesCS2D01G048000 chr6B 83.212 137 14 3 1348 1477 277616170 277616304 2.380000e-22 117
19 TraesCS2D01G048000 chr5A 80.519 154 21 5 1329 1475 277726087 277725936 3.990000e-20 110


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G048000 chr2D 17605644 17609418 3774 True 6972 6972 100.000 1 3775 1 chr2D.!!$R1 3774
1 TraesCS2D01G048000 chr2D 17631395 17635157 3762 True 6711 6711 98.809 1 3775 1 chr2D.!!$R2 3774
2 TraesCS2D01G048000 chr2A 19027861 19031648 3787 True 6329 6329 96.894 1 3775 1 chr2A.!!$R1 3774
3 TraesCS2D01G048000 chr2B 29552686 29556333 3647 False 2839 4811 95.396 1 3775 2 chr2B.!!$F4 3774
4 TraesCS2D01G048000 chr2B 29263988 29264664 676 False 396 396 77.855 2384 3088 1 chr2B.!!$F1 704
5 TraesCS2D01G048000 chr2B 29319225 29319901 676 False 396 396 77.855 2384 3088 1 chr2B.!!$F2 704
6 TraesCS2D01G048000 chr2B 29350343 29351020 677 False 390 390 77.716 2384 3088 1 chr2B.!!$F3 704

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
813 857 2.867624 TGCTTTCCACTTCAGCTTCAT 58.132 42.857 0.0 0.0 34.42 2.57 F
1590 1636 8.238631 GGTTAAAAATGCTTGATCTACCGTTTA 58.761 33.333 0.0 0.0 0.00 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1629 1675 0.901124 GGGCATGTTGGTTGGCAATA 59.099 50.0 1.92 0.0 41.14 1.90 R
3261 3316 1.107114 ATTTGTGGTTGGTCGTGCAA 58.893 45.0 0.00 0.0 0.00 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 243 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
201 244 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
202 245 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
203 246 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
204 247 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
205 248 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
206 249 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
207 250 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
208 251 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
209 252 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
210 253 5.139727 AGAGAGAGAGAGAGAGAGAGAGAG 58.860 50.000 0.00 0.0 0.00 3.20
211 254 5.103728 AGAGAGAGAGAGAGAGAGAGAGAGA 60.104 48.000 0.00 0.0 0.00 3.10
256 299 7.687941 TTCAGAGATTGGTAGGTTGAATTTC 57.312 36.000 0.00 0.0 0.00 2.17
813 857 2.867624 TGCTTTCCACTTCAGCTTCAT 58.132 42.857 0.00 0.0 34.42 2.57
1590 1636 8.238631 GGTTAAAAATGCTTGATCTACCGTTTA 58.761 33.333 0.00 0.0 0.00 2.01
3261 3316 2.693864 CTGACCATGGCCCTCCCT 60.694 66.667 13.04 0.0 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 243 9.950496 AATACATAATCTCTCTCTCTCTCTCTC 57.050 37.037 0.00 0.00 0.00 3.20
508 552 6.759356 AGGTAAAGGTTTTGTTGTTGTATTGC 59.241 34.615 0.00 0.00 0.00 3.56
813 857 3.252215 GTGTCATTTCCAACATGTCCGAA 59.748 43.478 0.00 0.71 0.00 4.30
1262 1308 4.185467 ACAAGTTGTTGATGCACACAAA 57.815 36.364 1.64 0.02 37.10 2.83
1385 1431 6.823531 TGCAAACACATTAATACGTGTCTAC 58.176 36.000 10.91 5.58 45.37 2.59
1590 1636 8.956426 CAAATTGTTGTGGTACATATTACTCCT 58.044 33.333 0.00 0.00 44.52 3.69
1629 1675 0.901124 GGGCATGTTGGTTGGCAATA 59.099 50.000 1.92 0.00 41.14 1.90
3261 3316 1.107114 ATTTGTGGTTGGTCGTGCAA 58.893 45.000 0.00 0.00 0.00 4.08
3605 3660 6.928492 TCGATGCTTGTGACATGCTTATATAA 59.072 34.615 21.56 2.93 35.87 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.