Multiple sequence alignment - TraesCS2D01G047900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G047900 chr2D 100.000 2374 0 0 1 2374 17606703 17604330 0.000000e+00 4385.0
1 TraesCS2D01G047900 chr2D 99.242 2376 11 3 1 2374 17632455 17630085 0.000000e+00 4281.0
2 TraesCS2D01G047900 chr2D 99.051 316 3 0 2059 2374 342543887 342543572 3.420000e-158 568.0
3 TraesCS2D01G047900 chr2D 98.734 316 4 0 2059 2374 290464387 290464702 1.590000e-156 562.0
4 TraesCS2D01G047900 chr2D 97.853 326 5 2 2049 2374 426566410 426566087 1.590000e-156 562.0
5 TraesCS2D01G047900 chr2A 98.356 2068 27 5 1 2064 19028922 19026858 0.000000e+00 3624.0
6 TraesCS2D01G047900 chr2B 93.517 1558 74 11 531 2063 29555805 29557360 0.000000e+00 2292.0
7 TraesCS2D01G047900 chr2B 97.642 424 7 2 1 422 29555363 29555785 0.000000e+00 725.0
8 TraesCS2D01G047900 chr2B 79.817 327 24 25 55 373 29319609 29319901 1.440000e-47 200.0
9 TraesCS2D01G047900 chr2B 79.817 327 24 23 55 373 29350728 29351020 1.440000e-47 200.0
10 TraesCS2D01G047900 chr2B 79.511 327 25 25 55 373 29264372 29264664 6.700000e-46 195.0
11 TraesCS2D01G047900 chr7D 98.738 317 4 0 2058 2374 116630126 116629810 4.430000e-157 564.0
12 TraesCS2D01G047900 chr7D 98.734 316 4 0 2059 2374 115485973 115486288 1.590000e-156 562.0
13 TraesCS2D01G047900 chr7D 98.734 316 4 0 2059 2374 540353205 540352890 1.590000e-156 562.0
14 TraesCS2D01G047900 chr6D 98.734 316 4 0 2059 2374 85150270 85150585 1.590000e-156 562.0
15 TraesCS2D01G047900 chr6D 84.444 90 12 2 1701 1789 82641480 82641392 1.170000e-13 87.9
16 TraesCS2D01G047900 chr1D 98.734 316 4 0 2059 2374 28594702 28594387 1.590000e-156 562.0
17 TraesCS2D01G047900 chr7B 94.382 89 5 0 1971 2059 740974046 740974134 1.140000e-28 137.0
18 TraesCS2D01G047900 chr5B 95.349 86 4 0 1974 2059 558416261 558416176 1.140000e-28 137.0
19 TraesCS2D01G047900 chrUn 94.318 88 5 0 1972 2059 108826718 108826805 4.120000e-28 135.0
20 TraesCS2D01G047900 chrUn 89.796 49 4 1 1746 1793 369749461 369749509 7.090000e-06 62.1
21 TraesCS2D01G047900 chr6B 94.382 89 4 1 1971 2059 132122627 132122714 4.120000e-28 135.0
22 TraesCS2D01G047900 chr7A 89.623 106 8 3 1954 2058 708020642 708020745 5.320000e-27 132.0
23 TraesCS2D01G047900 chr4B 89.524 105 8 3 1956 2059 594695156 594695258 1.910000e-26 130.0
24 TraesCS2D01G047900 chr3D 82.353 68 8 3 1655 1722 523333331 523333394 3.300000e-04 56.5
25 TraesCS2D01G047900 chr3B 84.211 57 9 0 1655 1711 642216801 642216745 3.300000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G047900 chr2D 17604330 17606703 2373 True 4385.0 4385 100.0000 1 2374 1 chr2D.!!$R1 2373
1 TraesCS2D01G047900 chr2D 17630085 17632455 2370 True 4281.0 4281 99.2420 1 2374 1 chr2D.!!$R2 2373
2 TraesCS2D01G047900 chr2A 19026858 19028922 2064 True 3624.0 3624 98.3560 1 2064 1 chr2A.!!$R1 2063
3 TraesCS2D01G047900 chr2B 29555363 29557360 1997 False 1508.5 2292 95.5795 1 2063 2 chr2B.!!$F4 2062

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
546 549 2.693864 CTGACCATGGCCCTCCCT 60.694 66.667 13.04 0.0 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1819 1849 7.123397 AGTTCAGCTACAGTGAAATCTATCTCA 59.877 37.037 0.0 0.0 35.71 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
546 549 2.693864 CTGACCATGGCCCTCCCT 60.694 66.667 13.04 0.0 0.00 4.20
2150 2181 5.985753 AGGGGAGAGTGTTGTCCACGTAT 62.986 52.174 0.00 0.0 44.77 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
546 549 1.107114 ATTTGTGGTTGGTCGTGCAA 58.893 45.000 0.00 0.00 0.00 4.08
890 893 6.928492 TCGATGCTTGTGACATGCTTATATAA 59.072 34.615 21.56 2.93 35.87 0.98
1818 1848 7.410120 TCAGCTACAGTGAAATCTATCTCAA 57.590 36.000 0.00 0.00 0.00 3.02
1819 1849 7.123397 AGTTCAGCTACAGTGAAATCTATCTCA 59.877 37.037 0.00 0.00 35.71 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.