Multiple sequence alignment - TraesCS2D01G046800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G046800 chr2D 100.000 2656 0 0 1 2656 17168616 17171271 0.000000e+00 4905.0
1 TraesCS2D01G046800 chr2D 97.108 1383 38 2 907 2289 17312634 17314014 0.000000e+00 2331.0
2 TraesCS2D01G046800 chr2D 93.261 920 23 7 1 907 17311677 17312570 0.000000e+00 1319.0
3 TraesCS2D01G046800 chr2D 93.029 373 23 3 2284 2656 17315331 17315700 2.330000e-150 542.0
4 TraesCS2D01G046800 chr2D 89.641 251 24 2 1291 1540 17208272 17208521 4.270000e-83 318.0
5 TraesCS2D01G046800 chr2A 96.286 1750 65 0 907 2656 18636297 18638046 0.000000e+00 2872.0
6 TraesCS2D01G046800 chr2A 91.031 1048 81 9 907 1952 18586716 18587752 0.000000e+00 1402.0
7 TraesCS2D01G046800 chr2A 92.795 916 31 13 1 907 18635344 18636233 0.000000e+00 1293.0
8 TraesCS2D01G046800 chr2A 87.296 921 73 20 1 907 18585765 18586655 0.000000e+00 1013.0
9 TraesCS2D01G046800 chr2A 78.209 592 116 10 2056 2646 669631648 669631069 1.500000e-97 366.0
10 TraesCS2D01G046800 chr2A 76.865 657 130 16 2016 2656 683008840 683009490 4.210000e-93 351.0
11 TraesCS2D01G046800 chr2A 79.208 101 19 2 2442 2541 763322698 763322797 4.740000e-08 69.4
12 TraesCS2D01G046800 chr2B 87.882 1048 92 17 907 1952 29046686 29047700 0.000000e+00 1199.0
13 TraesCS2D01G046800 chr2B 89.977 888 72 5 907 1793 29991498 29990627 0.000000e+00 1131.0
14 TraesCS2D01G046800 chr2B 89.054 877 77 10 41 907 29992429 29991562 0.000000e+00 1070.0
15 TraesCS2D01G046800 chr2B 94.822 618 31 1 1049 1666 28921248 28921864 0.000000e+00 963.0
16 TraesCS2D01G046800 chr2B 86.674 893 80 15 30 907 29045752 29046620 0.000000e+00 953.0
17 TraesCS2D01G046800 chr2B 90.099 707 69 1 1950 2656 28922387 28923092 0.000000e+00 917.0
18 TraesCS2D01G046800 chr2B 95.396 391 14 1 105 495 28920445 28920831 1.040000e-173 619.0
19 TraesCS2D01G046800 chr2B 96.109 257 10 0 1696 1952 28921864 28922120 1.140000e-113 420.0
20 TraesCS2D01G046800 chr2B 92.083 240 11 1 488 719 28921014 28921253 5.480000e-87 331.0
21 TraesCS2D01G046800 chr2B 95.327 107 5 0 1 107 28908289 28908395 1.260000e-38 171.0
22 TraesCS2D01G046800 chr2B 100.000 29 0 0 4 32 29992451 29992423 1.000000e-03 54.7
23 TraesCS2D01G046800 chr3A 81.746 504 84 7 2107 2607 629623572 629623074 5.290000e-112 414.0
24 TraesCS2D01G046800 chr3A 77.005 661 125 24 1997 2650 127841348 127841988 1.170000e-93 353.0
25 TraesCS2D01G046800 chr7A 78.097 662 124 17 2003 2656 691472138 691471490 1.480000e-107 399.0
26 TraesCS2D01G046800 chr6B 78.692 535 101 9 1998 2523 127391500 127390970 7.040000e-91 344.0
27 TraesCS2D01G046800 chr5D 76.847 609 118 20 2047 2648 445731050 445730458 3.300000e-84 322.0
28 TraesCS2D01G046800 chr4D 81.558 385 65 4 2003 2386 96497156 96497535 1.980000e-81 313.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G046800 chr2D 17168616 17171271 2655 False 4905.000000 4905 100.000000 1 2656 1 chr2D.!!$F1 2655
1 TraesCS2D01G046800 chr2D 17311677 17315700 4023 False 1397.333333 2331 94.466000 1 2656 3 chr2D.!!$F3 2655
2 TraesCS2D01G046800 chr2A 18635344 18638046 2702 False 2082.500000 2872 94.540500 1 2656 2 chr2A.!!$F4 2655
3 TraesCS2D01G046800 chr2A 18585765 18587752 1987 False 1207.500000 1402 89.163500 1 1952 2 chr2A.!!$F3 1951
4 TraesCS2D01G046800 chr2A 669631069 669631648 579 True 366.000000 366 78.209000 2056 2646 1 chr2A.!!$R1 590
5 TraesCS2D01G046800 chr2A 683008840 683009490 650 False 351.000000 351 76.865000 2016 2656 1 chr2A.!!$F1 640
6 TraesCS2D01G046800 chr2B 29045752 29047700 1948 False 1076.000000 1199 87.278000 30 1952 2 chr2B.!!$F3 1922
7 TraesCS2D01G046800 chr2B 29990627 29992451 1824 True 751.900000 1131 93.010333 4 1793 3 chr2B.!!$R1 1789
8 TraesCS2D01G046800 chr2B 28920445 28923092 2647 False 650.000000 963 93.701800 105 2656 5 chr2B.!!$F2 2551
9 TraesCS2D01G046800 chr3A 127841348 127841988 640 False 353.000000 353 77.005000 1997 2650 1 chr3A.!!$F1 653
10 TraesCS2D01G046800 chr7A 691471490 691472138 648 True 399.000000 399 78.097000 2003 2656 1 chr7A.!!$R1 653
11 TraesCS2D01G046800 chr6B 127390970 127391500 530 True 344.000000 344 78.692000 1998 2523 1 chr6B.!!$R1 525
12 TraesCS2D01G046800 chr5D 445730458 445731050 592 True 322.000000 322 76.847000 2047 2648 1 chr5D.!!$R1 601

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
454 460 1.859427 CTTTCATGTGCAGCGGCTGT 61.859 55.0 28.88 8.42 41.91 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2135 2701 0.804544 GGATCATCCGCGTTTCGTCA 60.805 55.0 4.92 0.0 36.19 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 5.741388 ACTTCACTGAAAGCACTTTACAG 57.259 39.130 15.15 15.15 37.60 2.74
327 332 6.739112 AGAAAGCCTTGACAAAATTACTGAC 58.261 36.000 0.00 0.00 0.00 3.51
454 460 1.859427 CTTTCATGTGCAGCGGCTGT 61.859 55.000 28.88 8.42 41.91 4.40
576 775 6.471233 TGACTCCACTAATATCTGTCCTTG 57.529 41.667 0.00 0.00 0.00 3.61
621 828 2.104281 ACTTTTAGTGCCCGACTGAAGT 59.896 45.455 0.00 0.00 37.47 3.01
815 1024 9.911788 AAGTATCACCATAATCTTCAGAATTGT 57.088 29.630 0.00 0.00 0.00 2.71
821 1030 9.045223 CACCATAATCTTCAGAATTGTCGATAA 57.955 33.333 0.00 0.00 0.00 1.75
890 1099 5.736951 TTTGGCTGCCATTTTTACTACAT 57.263 34.783 24.03 0.00 31.53 2.29
940 1215 9.727859 TTAGTTGTTAGGTTTTCTGCACATATA 57.272 29.630 0.00 0.00 0.00 0.86
1015 1290 4.898861 ACCAAACCATAGCCTTCAAGAAAA 59.101 37.500 0.00 0.00 0.00 2.29
1110 1386 4.583871 AGCTAGTTTCTTCTTGGTCATGG 58.416 43.478 0.00 0.00 0.00 3.66
1115 1391 5.388654 AGTTTCTTCTTGGTCATGGTCATT 58.611 37.500 0.00 0.00 0.00 2.57
1243 1519 1.302033 CTGCCTTGCTGGTCTTCGT 60.302 57.895 0.00 0.00 38.35 3.85
1269 1545 2.488153 GTTACTCAAGGCTTGGCGATTT 59.512 45.455 25.92 7.69 0.00 2.17
1374 1650 2.291209 TGACAACCACCATGCAATCT 57.709 45.000 0.00 0.00 0.00 2.40
1464 1740 4.961730 AGAACTAGTGCCATTCTCTGAGAT 59.038 41.667 8.42 0.00 0.00 2.75
1666 1944 9.744468 TTGTTGGAAAAATAAAGAAGAAGCTAC 57.256 29.630 0.00 0.00 0.00 3.58
1730 2009 3.006940 ACGTTCATGATTAACACGGCAT 58.993 40.909 18.24 0.00 0.00 4.40
2103 2663 6.484364 TCAAGCCCAAAAGAAAAGAGAAAT 57.516 33.333 0.00 0.00 0.00 2.17
2473 4369 2.516695 CCAGCATGCGCCACCATA 60.517 61.111 13.01 0.00 39.83 2.74
2477 4373 2.546494 GCATGCGCCACCATAGTCC 61.546 63.158 4.18 0.00 0.00 3.85
2494 4393 2.425592 CTGACGCCACCCTTGTCA 59.574 61.111 0.00 0.00 40.12 3.58
2552 4451 0.846693 AAGTGGGAGTGCAAGGAAGT 59.153 50.000 0.00 0.00 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
327 332 4.025396 CGACCTTGTAGCTGCAGATAAATG 60.025 45.833 20.43 12.98 0.00 2.32
454 460 1.883678 TTGGCTCTGGGATCTCATCA 58.116 50.000 0.00 0.00 0.00 3.07
576 775 8.307483 AGTGTCATCATGTAAGCATATAGGTAC 58.693 37.037 0.00 0.00 33.30 3.34
621 828 4.284746 CCTGCCTAAATTTTAACCCAACCA 59.715 41.667 0.00 0.00 0.00 3.67
821 1030 6.762661 GGCCAGTGACATAAATTATTTGCAAT 59.237 34.615 0.00 0.00 0.00 3.56
890 1099 4.631234 AGGTTATGGGACCAGTAGAATCA 58.369 43.478 0.00 0.00 42.35 2.57
1015 1290 9.257651 GAAGTTTGGATAGTATTATACGTGCTT 57.742 33.333 0.00 0.00 0.00 3.91
1129 1405 9.187996 TGCATAGGAATTTCATGAAGTTAATGA 57.812 29.630 23.16 0.00 32.24 2.57
1243 1519 2.879756 GCCAAGCCTTGAGTAACCATGA 60.880 50.000 5.89 0.00 0.00 3.07
1269 1545 3.246112 CACCGTCCCCTTGACCCA 61.246 66.667 0.00 0.00 41.18 4.51
1302 1578 3.807631 TTGCGCTGACAGCCTCGTT 62.808 57.895 21.55 0.00 38.18 3.85
1374 1650 2.579873 GCTACTATACTGGTCCCGTGA 58.420 52.381 0.00 0.00 0.00 4.35
1464 1740 2.270352 ATCTTGGGCGAACAGAACAA 57.730 45.000 0.00 0.00 0.00 2.83
1730 2009 8.494016 TTGCATGCATGAATTTTATTGATGAA 57.506 26.923 30.64 0.00 0.00 2.57
2103 2663 7.012327 CCGTCATTGGCATTAATTTCTCTTCTA 59.988 37.037 0.00 0.00 0.00 2.10
2135 2701 0.804544 GGATCATCCGCGTTTCGTCA 60.805 55.000 4.92 0.00 36.19 4.35
2473 4369 2.526873 AAGGGTGGCGTCAGGACT 60.527 61.111 0.00 0.00 0.00 3.85
2477 4373 1.003355 ATGACAAGGGTGGCGTCAG 60.003 57.895 0.00 0.00 42.53 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.