AutoCloner

Multiple sequence alignment - TraesCS2D01G042000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G042000	chr2D	100.000	3507	0	0	1	3507	14975692	14979198	0.000000e+00	6477.0
1	TraesCS2D01G042000	chr2D	93.750	832	40	6	963	1791	15015728	15016550	0.000000e+00	1238.0
2	TraesCS2D01G042000	chr2D	89.864	661	18	5	2871	3507	18276196	18276831	0.000000e+00	804.0
3	TraesCS2D01G042000	chr2D	76.980	808	141	32	923	1712	15583034	15583814	1.510000e-113	420.0
4	TraesCS2D01G042000	chr2D	88.462	234	9	2	2870	3085	18280473	18280240	2.080000e-67	267.0
5	TraesCS2D01G042000	chr2D	87.850	214	6	2	2871	3064	15009651	15009438	2.100000e-57	233.0
6	TraesCS2D01G042000	chr2D	91.667	48	4	0	1903	1950	429118557	429118510	2.260000e-07	67.6
7	TraesCS2D01G042000	chr2B	86.842	1406	127	31	504	1900	27070093	27071449	0.000000e+00	1519.0
8	TraesCS2D01G042000	chr2B	88.575	779	52	18	580	1342	27016941	27017698	0.000000e+00	911.0
9	TraesCS2D01G042000	chr2B	91.714	531	35	7	1375	1900	27017699	27018225	0.000000e+00	728.0
10	TraesCS2D01G042000	chr2B	90.280	535	39	6	1375	1898	27030362	27030894	0.000000e+00	688.0
11	TraesCS2D01G042000	chr2B	82.310	831	79	40	531	1342	27029580	27030361	0.000000e+00	658.0
12	TraesCS2D01G042000	chr2B	83.041	513	65	14	1	494	27052284	27052793	2.480000e-121	446.0
13	TraesCS2D01G042000	chr2B	88.811	286	16	4	1626	1898	27031851	27032133	1.560000e-88	337.0
14	TraesCS2D01G042000	chr2B	84.279	229	26	6	132	350	27016408	27016636	7.620000e-52	215.0
15	TraesCS2D01G042000	chr2A	88.986	1253	93	28	678	1900	17132985	17134222	0.000000e+00	1507.0
16	TraesCS2D01G042000	chr2A	88.491	643	49	14	2870	3507	158255467	158254845	0.000000e+00	754.0
17	TraesCS2D01G042000	chr2A	77.534	819	118	33	932	1706	17610261	17611057	1.930000e-117	433.0
18	TraesCS2D01G042000	chr2A	77.219	676	99	26	2871	3506	749132160	749132820	9.320000e-91	344.0
19	TraesCS2D01G042000	chrUn	95.243	925	30	7	1903	2819	29800028	29800946	0.000000e+00	1452.0
20	TraesCS2D01G042000	chrUn	100.000	51	0	0	2820	2870	29801020	29801070	1.040000e-15	95.3
21	TraesCS2D01G042000	chr4D	93.712	652	26	7	2870	3507	340753573	340754223	0.000000e+00	963.0
22	TraesCS2D01G042000	chr4D	86.992	246	14	2	2857	3085	340760296	340760052	9.660000e-66	261.0
23	TraesCS2D01G042000	chr4D	80.531	113	18	4	1903	2014	389003412	389003521	2.240000e-12	84.2
24	TraesCS2D01G042000	chr3D	93.598	656	22	4	2870	3507	179446687	179447340	0.000000e+00	961.0
25	TraesCS2D01G042000	chr3D	88.889	234	7	2	2869	3085	179453801	179453570	1.600000e-68	270.0
26	TraesCS2D01G042000	chr3D	95.556	45	2	0	1900	1944	565690338	565690294	4.860000e-09	73.1
27	TraesCS2D01G042000	chr4B	92.542	657	29	4	2871	3507	522496276	522495620	0.000000e+00	924.0
28	TraesCS2D01G042000	chr4B	81.250	656	54	27	2226	2819	490998088	490997440	1.910000e-127	466.0
29	TraesCS2D01G042000	chr4B	85.892	241	16	5	1897	2120	490998327	490998088	1.260000e-59	241.0
30	TraesCS2D01G042000	chr4B	96.154	52	1	1	2823	2873	490997368	490997317	2.240000e-12	84.2
31	TraesCS2D01G042000	chr1D	92.481	665	20	5	2871	3507	447262895	447263557	0.000000e+00	924.0
32	TraesCS2D01G042000	chr1D	95.775	71	3	0	3015	3085	447269395	447269325	7.950000e-22	115.0
33	TraesCS2D01G042000	chr1D	95.556	45	2	0	1900	1944	183025893	183025849	4.860000e-09	73.1
34	TraesCS2D01G042000	chr3B	91.541	662	30	4	2871	3506	22218521	22217860	0.000000e+00	889.0
35	TraesCS2D01G042000	chr3B	89.655	232	7	1	2871	3085	22211267	22211498	2.670000e-71	279.0
36	TraesCS2D01G042000	chr1A	88.369	662	47	9	2872	3507	307695535	307694878	0.000000e+00	769.0
37	TraesCS2D01G042000	chr1B	90.754	411	21	8	2226	2627	612039408	612039006	1.850000e-147	532.0
38	TraesCS2D01G042000	chr1B	84.158	202	14	4	1937	2120	612039609	612039408	2.780000e-41	180.0
39	TraesCS2D01G042000	chr1B	95.556	45	2	0	1900	1944	255505711	255505667	4.860000e-09	73.1
40	TraesCS2D01G042000	chr6A	77.632	684	89	34	2871	3506	533237533	533236866	1.200000e-94	357.0
41	TraesCS2D01G042000	chr5D	90.909	55	5	0	1901	1955	3764557	3764611	1.350000e-09	75.0
42	TraesCS2D01G042000	chr7B	90.196	51	4	1	1899	1949	190119809	190119858	8.130000e-07	65.8
43	TraesCS2D01G042000	chr7A	97.368	38	0	1	1898	1935	60640517	60640553	2.920000e-06	63.9
44	TraesCS2D01G042000	chr4A	86.441	59	6	2	2092	2149	709208937	709208880	2.920000e-06	63.9

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G042000	chr2D	14975692	14979198	3506	False	6477.000000	6477	100.000000	1	3507	1	chr2D.!!$F1	3506
1	TraesCS2D01G042000	chr2D	15015728	15016550	822	False	1238.000000	1238	93.750000	963	1791	1	chr2D.!!$F2	828
2	TraesCS2D01G042000	chr2D	18276196	18276831	635	False	804.000000	804	89.864000	2871	3507	1	chr2D.!!$F4	636
3	TraesCS2D01G042000	chr2D	15583034	15583814	780	False	420.000000	420	76.980000	923	1712	1	chr2D.!!$F3	789
4	TraesCS2D01G042000	chr2B	27070093	27071449	1356	False	1519.000000	1519	86.842000	504	1900	1	chr2B.!!$F2	1396
5	TraesCS2D01G042000	chr2B	27016408	27018225	1817	False	618.000000	911	88.189333	132	1900	3	chr2B.!!$F3	1768
6	TraesCS2D01G042000	chr2B	27029580	27032133	2553	False	561.000000	688	87.133667	531	1898	3	chr2B.!!$F4	1367
7	TraesCS2D01G042000	chr2B	27052284	27052793	509	False	446.000000	446	83.041000	1	494	1	chr2B.!!$F1	493
8	TraesCS2D01G042000	chr2A	17132985	17134222	1237	False	1507.000000	1507	88.986000	678	1900	1	chr2A.!!$F1	1222
9	TraesCS2D01G042000	chr2A	158254845	158255467	622	True	754.000000	754	88.491000	2870	3507	1	chr2A.!!$R1	637
10	TraesCS2D01G042000	chr2A	17610261	17611057	796	False	433.000000	433	77.534000	932	1706	1	chr2A.!!$F2	774
11	TraesCS2D01G042000	chr2A	749132160	749132820	660	False	344.000000	344	77.219000	2871	3506	1	chr2A.!!$F3	635
12	TraesCS2D01G042000	chrUn	29800028	29801070	1042	False	773.650000	1452	97.621500	1903	2870	2	chrUn.!!$F1	967
13	TraesCS2D01G042000	chr4D	340753573	340754223	650	False	963.000000	963	93.712000	2870	3507	1	chr4D.!!$F1	637
14	TraesCS2D01G042000	chr3D	179446687	179447340	653	False	961.000000	961	93.598000	2870	3507	1	chr3D.!!$F1	637
15	TraesCS2D01G042000	chr4B	522495620	522496276	656	True	924.000000	924	92.542000	2871	3507	1	chr4B.!!$R1	636
16	TraesCS2D01G042000	chr4B	490997317	490998327	1010	True	263.733333	466	87.765333	1897	2873	3	chr4B.!!$R2	976
17	TraesCS2D01G042000	chr1D	447262895	447263557	662	False	924.000000	924	92.481000	2871	3507	1	chr1D.!!$F1	636
18	TraesCS2D01G042000	chr3B	22217860	22218521	661	True	889.000000	889	91.541000	2871	3506	1	chr3B.!!$R1	635
19	TraesCS2D01G042000	chr1A	307694878	307695535	657	True	769.000000	769	88.369000	2872	3507	1	chr1A.!!$R1	635
20	TraesCS2D01G042000	chr1B	612039006	612039609	603	True	356.000000	532	87.456000	1937	2627	2	chr1B.!!$R2	690
21	TraesCS2D01G042000	chr6A	533236866	533237533	667	True	357.000000	357	77.632000	2871	3506	1	chr6A.!!$R1	635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
116	117	0.036010	GCAGTGCAGTGTAGGGTCAT	60.036	55.0	22.22	0.0	0.00	3.06	F
1015	1222	0.440371	GAGGAGAAAACGAGCAAGCG	59.560	55.0	0.00	0.0	37.29	4.68	F
1800	3302	1.057471	TCAATAACACGGTGACCCCA	58.943	50.0	16.29	0.0	0.00	4.96	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1482	1741	0.025513	GCTCGATGACACGCACATTC	59.974	55.0	0.00	0.0	0.00	2.67	R
1843	3347	0.595567	CCAAGCACATGCACACACAC	60.596	55.0	6.64	0.0	45.16	3.82	R
3284	5060	0.249741	CTAACCCTAATCCACGGGCG	60.250	60.0	0.00	0.0	44.63	6.13	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
36	37	2.125753	GAGAGCTCCTGTGTGCCG	60.126	66.667	10.93	0.00	0.00	5.69
45	46	3.871248	CTGTGTGCCGCTCTCTGCA	62.871	63.158	0.00	0.00	43.06	4.41
84	85	2.892425	CGGGCAAGCCATCGACTC	60.892	66.667	13.87	0.00	37.98	3.36
113	114	0.401738	ATTGCAGTGCAGTGTAGGGT	59.598	50.000	22.22	5.99	40.61	4.34
116	117	0.036010	GCAGTGCAGTGTAGGGTCAT	60.036	55.000	22.22	0.00	0.00	3.06
142	143	5.139435	CATAGATGGAATGAAGCGGTCTA	57.861	43.478	0.00	0.00	0.00	2.59
165	166	1.278127	ACCATAGAGACCCGGTTTGTG	59.722	52.381	0.00	0.00	0.00	3.33
321	331	7.223584	AGTTAGATTTTCCCAAAACCCAAATG	58.776	34.615	0.00	0.00	32.37	2.32
327	337	5.904362	TTCCCAAAACCCAAATGTTTTTG	57.096	34.783	0.00	9.10	43.90	2.44
328	338	5.179452	TCCCAAAACCCAAATGTTTTTGA	57.821	34.783	14.41	1.37	43.90	2.69
330	340	6.190587	TCCCAAAACCCAAATGTTTTTGAAT	58.809	32.000	14.41	0.00	43.90	2.57
333	343	7.277319	CCCAAAACCCAAATGTTTTTGAATTTG	59.723	33.333	14.41	9.86	43.90	2.32
334	344	7.816513	CCAAAACCCAAATGTTTTTGAATTTGT	59.183	29.630	14.41	0.00	43.90	2.83
335	345	8.858186	CAAAACCCAAATGTTTTTGAATTTGTC	58.142	29.630	9.98	0.00	43.90	3.18
336	346	7.693969	AACCCAAATGTTTTTGAATTTGTCA	57.306	28.000	7.20	0.00	44.11	3.58
338	348	7.534282	ACCCAAATGTTTTTGAATTTGTCAAC	58.466	30.769	7.20	0.00	46.09	3.18
339	349	7.175641	ACCCAAATGTTTTTGAATTTGTCAACA	59.824	29.630	7.20	0.00	46.09	3.33
410	490	6.462768	CCCTGATTTTTCTGGACAAAATGTGA	60.463	38.462	0.94	0.00	34.61	3.58
414	494	8.881743	TGATTTTTCTGGACAAAATGTGAAAAG	58.118	29.630	0.00	0.00	33.96	2.27
420	500	4.099266	TGGACAAAATGTGAAAAGGGTGAG	59.901	41.667	0.00	0.00	0.00	3.51
425	505	6.939730	ACAAAATGTGAAAAGGGTGAGTTTTT	59.060	30.769	0.00	0.00	0.00	1.94
495	576	5.886960	AGGGACATTCTTTGAAATTCTCG	57.113	39.130	0.00	0.00	0.00	4.04
496	577	5.316987	AGGGACATTCTTTGAAATTCTCGT	58.683	37.500	0.00	0.00	0.00	4.18
497	578	5.182001	AGGGACATTCTTTGAAATTCTCGTG	59.818	40.000	0.00	0.00	0.00	4.35
498	579	5.393962	GGACATTCTTTGAAATTCTCGTGG	58.606	41.667	0.00	0.00	0.00	4.94

Showing 1 to 25 of 71 entries

Previous1 2 3Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
8	9	1.143684	AGGAGCTCTCAAAAACAGGCA	59.856	47.619	14.64	0.00	0.00	4.75
17	18	1.372683	GGCACACAGGAGCTCTCAA	59.627	57.895	14.64	0.00	0.00	3.02
36	37	1.467734	CACCAAACTGATGCAGAGAGC	59.532	52.381	0.82	0.00	45.96	4.09
45	46	1.263217	GCGAAACGACACCAAACTGAT	59.737	47.619	0.00	0.00	0.00	2.90
90	91	1.466167	CTACACTGCACTGCAATGGAC	59.534	52.381	16.38	0.00	40.24	4.02
101	102	0.613260	GGTCATGACCCTACACTGCA	59.387	55.000	31.37	0.00	45.68	4.41
142	143	2.764572	CAAACCGGGTCTCTATGGTAGT	59.235	50.000	6.32	0.00	33.45	2.73
152	153	1.125711	AGCTACCACAAACCGGGTCT	61.126	55.000	6.32	0.00	38.60	3.85
205	206	0.753867	TCGCTACAACAACCAGACCA	59.246	50.000	0.00	0.00	0.00	4.02
290	300	9.027202	GGGTTTTGGGAAAATCTAACTAATGTA	57.973	33.333	0.00	0.00	32.12	2.29
296	306	6.816616	TTTGGGTTTTGGGAAAATCTAACT	57.183	33.333	0.00	0.00	32.65	2.24
297	307	6.995686	ACATTTGGGTTTTGGGAAAATCTAAC	59.004	34.615	0.00	0.00	32.65	2.34
381	392	4.402616	TGTCCAGAAAAATCAGGGGATT	57.597	40.909	0.00	0.00	45.57	3.01
383	394	3.893753	TTGTCCAGAAAAATCAGGGGA	57.106	42.857	0.00	0.00	0.00	4.81
388	399	8.783833	TTTTCACATTTTGTCCAGAAAAATCA	57.216	26.923	0.00	0.00	35.55	2.57
389	400	8.337532	CCTTTTCACATTTTGTCCAGAAAAATC	58.662	33.333	0.00	0.00	35.55	2.17
391	402	6.597280	CCCTTTTCACATTTTGTCCAGAAAAA	59.403	34.615	0.00	0.00	32.87	1.94
396	476	4.099266	TCACCCTTTTCACATTTTGTCCAG	59.901	41.667	0.00	0.00	0.00	3.86
399	479	5.262588	ACTCACCCTTTTCACATTTTGTC	57.737	39.130	0.00	0.00	0.00	3.18
472	553	6.371548	CACGAGAATTTCAAAGAATGTCCCTA	59.628	38.462	0.00	0.00	0.00	3.53
476	557	6.002062	ACCACGAGAATTTCAAAGAATGTC	57.998	37.500	0.00	0.00	0.00	3.06
482	563	4.091509	CCTACGACCACGAGAATTTCAAAG	59.908	45.833	0.00	0.00	42.66	2.77
484	565	3.581755	CCTACGACCACGAGAATTTCAA	58.418	45.455	0.00	0.00	42.66	2.69
494	575	1.897398	GCACTTTGCCTACGACCACG	61.897	60.000	0.00	0.00	40.62	4.94
495	576	1.866925	GCACTTTGCCTACGACCAC	59.133	57.895	0.00	0.00	37.42	4.16

Showing 1 to 25 of 86 entries

Previous1 2 3 4Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.