Multiple sequence alignment - TraesCS2D01G032300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G032300 chr2D 100.000 5678 0 0 1 5678 12735577 12729900 0.000000e+00 10486
1 TraesCS2D01G032300 chr2D 98.214 112 2 0 5567 5678 649294990 649295101 4.490000e-46 196
2 TraesCS2D01G032300 chr7A 97.128 5502 141 7 1 5488 270895304 270889806 0.000000e+00 9269
3 TraesCS2D01G032300 chr7A 95.430 3020 108 13 2673 5678 527903505 527906508 0.000000e+00 4785
4 TraesCS2D01G032300 chr7A 96.876 2593 78 2 1 2591 527900919 527903510 0.000000e+00 4337
5 TraesCS2D01G032300 chr7A 97.537 203 5 0 5476 5678 270889776 270889574 1.170000e-91 348
6 TraesCS2D01G032300 chr6D 98.539 4995 57 9 695 5678 6819846 6824835 0.000000e+00 8805
7 TraesCS2D01G032300 chr6D 91.477 4752 341 31 967 5678 360756204 360751477 0.000000e+00 6473
8 TraesCS2D01G032300 chr6D 99.145 702 4 1 1 700 6778610 6779311 0.000000e+00 1262
9 TraesCS2D01G032300 chr1D 92.194 4740 314 31 967 5678 42047165 42042454 0.000000e+00 6652
10 TraesCS2D01G032300 chr1D 93.750 608 34 3 1 605 42048051 42047445 0.000000e+00 909
11 TraesCS2D01G032300 chr1D 93.257 608 37 3 1 605 485430446 485429840 0.000000e+00 893
12 TraesCS2D01G032300 chr1D 95.853 217 9 0 751 967 162591017 162591233 9.050000e-93 351
13 TraesCS2D01G032300 chr1D 96.262 214 8 0 754 967 485429844 485429631 9.050000e-93 351
14 TraesCS2D01G032300 chr1D 87.027 185 14 3 5494 5678 326521441 326521267 3.470000e-47 200
15 TraesCS2D01G032300 chr7D 91.675 4733 339 27 967 5678 346632956 346628258 0.000000e+00 6506
16 TraesCS2D01G032300 chr7D 88.218 1044 98 8 4450 5475 608293214 608292178 0.000000e+00 1223
17 TraesCS2D01G032300 chr7D 94.079 608 32 3 1 605 346633842 346633236 0.000000e+00 920
18 TraesCS2D01G032300 chr7D 93.257 608 37 3 1 605 608294727 608294121 0.000000e+00 893
19 TraesCS2D01G032300 chr7D 96.729 214 7 0 754 967 608294125 608293912 1.950000e-94 357
20 TraesCS2D01G032300 chr6A 92.751 4511 293 22 967 5455 46105738 46110236 0.000000e+00 6488
21 TraesCS2D01G032300 chr6A 92.686 4512 295 23 967 5455 46136654 46141153 0.000000e+00 6471
22 TraesCS2D01G032300 chr6A 93.257 608 37 3 1 605 46135768 46136374 0.000000e+00 893
23 TraesCS2D01G032300 chr6A 95.853 217 9 0 751 967 46105451 46105667 9.050000e-93 351
24 TraesCS2D01G032300 chr6A 95.853 217 9 0 751 967 46136367 46136583 9.050000e-93 351
25 TraesCS2D01G032300 chr3B 92.518 3956 265 17 1520 5455 777043091 777039147 0.000000e+00 5637
26 TraesCS2D01G032300 chr4B 92.524 3946 262 16 1531 5455 622890221 622886288 0.000000e+00 5622
27 TraesCS2D01G032300 chr5A 96.819 2138 47 7 3553 5678 553300982 553298854 0.000000e+00 3552
28 TraesCS2D01G032300 chr3A 93.846 195 8 2 5484 5678 707835636 707835826 2.000000e-74 291
29 TraesCS2D01G032300 chr3D 93.333 195 9 1 5484 5678 573207412 573207602 9.310000e-73 285
30 TraesCS2D01G032300 chr1B 85.792 183 16 3 5496 5678 440471258 440471086 9.710000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G032300 chr2D 12729900 12735577 5677 True 10486.000000 10486 100.000000 1 5678 1 chr2D.!!$R1 5677
1 TraesCS2D01G032300 chr7A 270889574 270895304 5730 True 4808.500000 9269 97.332500 1 5678 2 chr7A.!!$R1 5677
2 TraesCS2D01G032300 chr7A 527900919 527906508 5589 False 4561.000000 4785 96.153000 1 5678 2 chr7A.!!$F1 5677
3 TraesCS2D01G032300 chr6D 6819846 6824835 4989 False 8805.000000 8805 98.539000 695 5678 1 chr6D.!!$F2 4983
4 TraesCS2D01G032300 chr6D 360751477 360756204 4727 True 6473.000000 6473 91.477000 967 5678 1 chr6D.!!$R1 4711
5 TraesCS2D01G032300 chr6D 6778610 6779311 701 False 1262.000000 1262 99.145000 1 700 1 chr6D.!!$F1 699
6 TraesCS2D01G032300 chr1D 42042454 42048051 5597 True 3780.500000 6652 92.972000 1 5678 2 chr1D.!!$R2 5677
7 TraesCS2D01G032300 chr1D 485429631 485430446 815 True 622.000000 893 94.759500 1 967 2 chr1D.!!$R3 966
8 TraesCS2D01G032300 chr7D 346628258 346633842 5584 True 3713.000000 6506 92.877000 1 5678 2 chr7D.!!$R1 5677
9 TraesCS2D01G032300 chr7D 608292178 608294727 2549 True 824.333333 1223 92.734667 1 5475 3 chr7D.!!$R2 5474
10 TraesCS2D01G032300 chr6A 46105451 46110236 4785 False 3419.500000 6488 94.302000 751 5455 2 chr6A.!!$F1 4704
11 TraesCS2D01G032300 chr6A 46135768 46141153 5385 False 2571.666667 6471 93.932000 1 5455 3 chr6A.!!$F2 5454
12 TraesCS2D01G032300 chr3B 777039147 777043091 3944 True 5637.000000 5637 92.518000 1520 5455 1 chr3B.!!$R1 3935
13 TraesCS2D01G032300 chr4B 622886288 622890221 3933 True 5622.000000 5622 92.524000 1531 5455 1 chr4B.!!$R1 3924
14 TraesCS2D01G032300 chr5A 553298854 553300982 2128 True 3552.000000 3552 96.819000 3553 5678 1 chr5A.!!$R1 2125

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
146 149 2.589610 ATCTAGCTCGAGGGGTGCCA 62.590 60.000 15.58 0.0 35.77 4.92 F
1215 1360 4.142790 TGTTAGGATACGAGAGATGGACC 58.857 47.826 0.00 0.0 46.39 4.46 F
1856 2001 4.536090 AGTAATGGTTCACCCTTCTCATGA 59.464 41.667 0.00 0.0 34.29 3.07 F
3150 3298 5.336102 TGATAGTGCATCTCCCATATGAGA 58.664 41.667 3.65 0.0 45.01 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1215 1360 0.179026 CATCAGACTCCCCATGGCTG 60.179 60.000 6.09 8.13 0.00 4.85 R
3171 3319 8.499403 TCAAAAACATACATCCAACGATATGA 57.501 30.769 0.00 0.00 0.00 2.15 R
3343 3493 6.403333 TGTACAATACAAGCTTCAACGATC 57.597 37.500 0.00 0.00 35.38 3.69 R
5118 5295 0.741915 CTTCTAGTCTGAGACCGGCC 59.258 60.000 9.33 0.00 32.18 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 149 2.589610 ATCTAGCTCGAGGGGTGCCA 62.590 60.000 15.58 0.00 35.77 4.92
1215 1360 4.142790 TGTTAGGATACGAGAGATGGACC 58.857 47.826 0.00 0.00 46.39 4.46
1856 2001 4.536090 AGTAATGGTTCACCCTTCTCATGA 59.464 41.667 0.00 0.00 34.29 3.07
3150 3298 5.336102 TGATAGTGCATCTCCCATATGAGA 58.664 41.667 3.65 0.00 45.01 3.27
3208 3356 9.109393 GATGTATGTTTTTGAGAGGTATGCTAA 57.891 33.333 0.00 0.00 0.00 3.09
3343 3493 1.376037 GGCAAGAGTGGAGGGTTCG 60.376 63.158 0.00 0.00 0.00 3.95
3367 3517 6.237835 CGATCGTTGAAGCTTGTATTGTACAT 60.238 38.462 2.10 0.00 38.68 2.29
3555 3705 5.784177 ACTATCACGTGAAGAGTTGAATGT 58.216 37.500 24.13 3.58 0.00 2.71
4144 4299 7.685481 TGGTAGAAAAATTGAGATGGTACTCA 58.315 34.615 0.00 0.00 43.83 3.41
4567 4722 5.350504 TGATGAGGGAGAAGAATCTTCAC 57.649 43.478 23.20 17.22 35.54 3.18
4931 5105 7.385267 TGCATGCCTTTTGTTATCATTTACTT 58.615 30.769 16.68 0.00 0.00 2.24
5118 5295 3.662247 ACACCAAGAACTAGGACTTCG 57.338 47.619 0.00 0.00 0.00 3.79
5136 5313 1.030488 CGGCCGGTCTCAGACTAGAA 61.030 60.000 20.10 0.00 32.47 2.10
5274 5457 3.924576 GGGAAAGGCACCCATACAT 57.075 52.632 9.05 0.00 46.05 2.29
5411 5594 1.417890 CTGGCCCGGAAGTAAGATCAT 59.582 52.381 0.73 0.00 0.00 2.45
5619 5897 0.560688 AAACTGGTGGATGGGTGGTT 59.439 50.000 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 149 3.394836 GGAAGCAGAGGGACGCCT 61.395 66.667 0.00 0.00 0.00 5.52
628 631 4.371975 GCACCAGGCGAGTTGTAA 57.628 55.556 0.00 0.00 0.00 2.41
1215 1360 0.179026 CATCAGACTCCCCATGGCTG 60.179 60.000 6.09 8.13 0.00 4.85
1332 1477 4.233408 GCAGCTTTTGTTGGCTCG 57.767 55.556 0.00 0.00 36.59 5.03
1856 2001 7.340487 CCTTATTAAACTCCTTCCAAGCTTCAT 59.660 37.037 0.00 0.00 0.00 2.57
3171 3319 8.499403 TCAAAAACATACATCCAACGATATGA 57.501 30.769 0.00 0.00 0.00 2.15
3343 3493 6.403333 TGTACAATACAAGCTTCAACGATC 57.597 37.500 0.00 0.00 35.38 3.69
3555 3705 7.230510 AGTTGATCAAAATGTACAACCTTGCTA 59.769 33.333 10.35 0.00 40.77 3.49
4567 4722 5.521735 CGGTACTCTCTTCCAAATCATCTTG 59.478 44.000 0.00 0.00 0.00 3.02
5118 5295 0.741915 CTTCTAGTCTGAGACCGGCC 59.258 60.000 9.33 0.00 32.18 6.13
5136 5313 6.793505 ACTATAAGAGGTCGGTCAATTTCT 57.206 37.500 0.00 0.00 0.00 2.52
5194 5371 7.994425 TGAATATTGCTCCAACAAGTAAAGA 57.006 32.000 0.00 0.00 31.96 2.52
5274 5457 0.525455 CGTTGATGGATCACGAGCGA 60.525 55.000 0.00 0.00 36.36 4.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.