Multiple sequence alignment - TraesCS2D01G022600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G022600 chr2D 100.000 2591 0 0 1 2591 10294105 10296695 0.000000e+00 4785.0
1 TraesCS2D01G022600 chr2D 99.305 2591 18 0 1 2591 10494362 10491772 0.000000e+00 4686.0
2 TraesCS2D01G022600 chr2D 99.267 2591 18 1 1 2591 10511413 10508824 0.000000e+00 4678.0
3 TraesCS2D01G022600 chr2D 95.882 1020 40 2 1573 2591 10224179 10225197 0.000000e+00 1650.0
4 TraesCS2D01G022600 chr2D 79.693 261 38 7 2326 2586 579754603 579754848 9.530000e-40 174.0
5 TraesCS2D01G022600 chr2B 95.299 1574 69 4 1 1573 15818360 15816791 0.000000e+00 2492.0
6 TraesCS2D01G022600 chr2B 95.235 1574 70 4 1 1573 15695054 15693485 0.000000e+00 2486.0
7 TraesCS2D01G022600 chr2B 95.235 1574 70 4 1 1573 15917331 15915762 0.000000e+00 2486.0
8 TraesCS2D01G022600 chr2B 94.536 1574 81 2 1 1573 15638467 15636898 0.000000e+00 2425.0
9 TraesCS2D01G022600 chr2B 94.536 1574 81 2 1 1573 15882837 15881268 0.000000e+00 2425.0
10 TraesCS2D01G022600 chr2B 82.443 262 34 7 2326 2587 763375539 763375290 4.340000e-53 219.0
11 TraesCS2D01G022600 chr2B 81.923 260 31 6 2334 2591 485445788 485445543 3.380000e-49 206.0
12 TraesCS2D01G022600 chrUn 94.663 1574 79 2 1 1573 339546930 339548499 0.000000e+00 2436.0
13 TraesCS2D01G022600 chrUn 94.473 1574 82 2 1 1573 339561113 339559544 0.000000e+00 2420.0
14 TraesCS2D01G022600 chr2A 82.955 264 31 8 2328 2590 42015708 42015458 2.590000e-55 226.0
15 TraesCS2D01G022600 chr2A 89.706 68 6 1 1666 1732 296955916 296955983 4.590000e-13 86.1
16 TraesCS2D01G022600 chr1D 82.759 261 33 5 2326 2586 418520061 418519813 3.360000e-54 222.0
17 TraesCS2D01G022600 chr1D 84.472 161 21 4 1825 1984 451383598 451383441 3.450000e-34 156.0
18 TraesCS2D01G022600 chr1B 82.824 262 31 6 2326 2586 57805263 57805511 3.360000e-54 222.0
19 TraesCS2D01G022600 chr1B 77.391 230 40 4 2357 2586 25477616 25477399 2.710000e-25 126.0
20 TraesCS2D01G022600 chr4D 82.692 260 33 6 2328 2587 504283527 504283774 1.210000e-53 220.0
21 TraesCS2D01G022600 chr4D 87.500 80 7 2 1656 1732 392250265 392250344 3.550000e-14 89.8
22 TraesCS2D01G022600 chr3D 82.443 262 34 6 2326 2587 10639620 10639869 4.340000e-53 219.0
23 TraesCS2D01G022600 chr3D 80.240 167 24 9 1825 1984 337315473 337315309 1.630000e-22 117.0
24 TraesCS2D01G022600 chr6A 81.853 259 35 8 2328 2586 472952214 472951968 9.400000e-50 207.0
25 TraesCS2D01G022600 chr3B 81.154 260 36 6 2326 2585 685397464 685397218 2.030000e-46 196.0
26 TraesCS2D01G022600 chr3B 88.732 71 7 1 1664 1733 325067881 325067811 4.590000e-13 86.1
27 TraesCS2D01G022600 chr7D 78.764 259 40 5 2328 2586 105425613 105425370 2.670000e-35 159.0
28 TraesCS2D01G022600 chr7D 86.598 97 11 2 1825 1920 582161306 582161211 3.530000e-19 106.0
29 TraesCS2D01G022600 chr1A 81.383 188 27 6 1816 2000 571340751 571340933 2.080000e-31 147.0
30 TraesCS2D01G022600 chr7A 89.189 74 5 3 1661 1732 208230384 208230456 3.550000e-14 89.8
31 TraesCS2D01G022600 chr7A 80.556 108 17 4 1825 1930 674088505 674088400 2.140000e-11 80.5
32 TraesCS2D01G022600 chr6D 90.625 64 5 1 1674 1736 289067104 289067041 1.650000e-12 84.2
33 TraesCS2D01G022600 chr5D 88.571 70 4 3 1664 1732 34237686 34237620 5.940000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G022600 chr2D 10294105 10296695 2590 False 4785 4785 100.000 1 2591 1 chr2D.!!$F2 2590
1 TraesCS2D01G022600 chr2D 10491772 10494362 2590 True 4686 4686 99.305 1 2591 1 chr2D.!!$R1 2590
2 TraesCS2D01G022600 chr2D 10508824 10511413 2589 True 4678 4678 99.267 1 2591 1 chr2D.!!$R2 2590
3 TraesCS2D01G022600 chr2D 10224179 10225197 1018 False 1650 1650 95.882 1573 2591 1 chr2D.!!$F1 1018
4 TraesCS2D01G022600 chr2B 15816791 15818360 1569 True 2492 2492 95.299 1 1573 1 chr2B.!!$R3 1572
5 TraesCS2D01G022600 chr2B 15693485 15695054 1569 True 2486 2486 95.235 1 1573 1 chr2B.!!$R2 1572
6 TraesCS2D01G022600 chr2B 15915762 15917331 1569 True 2486 2486 95.235 1 1573 1 chr2B.!!$R5 1572
7 TraesCS2D01G022600 chr2B 15636898 15638467 1569 True 2425 2425 94.536 1 1573 1 chr2B.!!$R1 1572
8 TraesCS2D01G022600 chr2B 15881268 15882837 1569 True 2425 2425 94.536 1 1573 1 chr2B.!!$R4 1572
9 TraesCS2D01G022600 chrUn 339546930 339548499 1569 False 2436 2436 94.663 1 1573 1 chrUn.!!$F1 1572
10 TraesCS2D01G022600 chrUn 339559544 339561113 1569 True 2420 2420 94.473 1 1573 1 chrUn.!!$R1 1572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
696 697 0.174162 GGATGCCATGCAAACACTCC 59.826 55.0 0.0 0.0 43.62 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1992 1995 2.521103 TCAGTCCCTGAGCATAGCC 58.479 57.895 0.0 0.0 35.39 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
696 697 0.174162 GGATGCCATGCAAACACTCC 59.826 55.000 0.00 0.00 43.62 3.85
1199 1201 0.466124 GAGGCCTTCCGCTTACATCT 59.534 55.000 6.77 0.00 37.74 2.90
1514 1516 0.472471 ACTTGGACAAAGCTTCCCGA 59.528 50.000 0.00 0.83 39.76 5.14
1752 1754 4.351874 TTCAGACCTACCCTGTTTTCTG 57.648 45.455 0.00 0.00 33.57 3.02
1992 1995 1.990799 TATTTGCTCCAGACGTCACG 58.009 50.000 19.50 8.22 0.00 4.35
2517 2520 2.436417 ACAACGATGCTAGGCAACAAT 58.564 42.857 0.00 0.00 43.62 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
696 697 3.061848 GGGGTCATGCAACCGGTG 61.062 66.667 8.52 3.35 40.46 4.94
1514 1516 7.406031 TCTTGGAGATTGATACTCTTAACGT 57.594 36.000 0.00 0.00 35.10 3.99
1992 1995 2.521103 TCAGTCCCTGAGCATAGCC 58.479 57.895 0.00 0.00 35.39 3.93
2517 2520 6.299141 GCTCCCTGAAGATGGAATAAATGTA 58.701 40.000 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.