Multiple sequence alignment - TraesCS2D01G018900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G018900 chr2D 100.000 2303 0 0 1 2303 8945883 8948185 0.000000e+00 4253.0
1 TraesCS2D01G018900 chr2D 98.351 2304 36 2 1 2303 536084124 536081822 0.000000e+00 4043.0
2 TraesCS2D01G018900 chr2D 98.393 1929 27 3 1 1928 616988193 616990118 0.000000e+00 3387.0
3 TraesCS2D01G018900 chr2D 96.362 1292 25 5 1034 2303 577708574 577707283 0.000000e+00 2106.0
4 TraesCS2D01G018900 chr2D 97.966 295 6 0 2009 2303 616990155 616990449 1.580000e-141 512.0
5 TraesCS2D01G018900 chr2D 100.000 50 0 0 2006 2055 616990110 616990159 2.440000e-15 93.5
6 TraesCS2D01G018900 chr5D 97.569 2304 32 6 1 2303 357884351 357886631 0.000000e+00 3923.0
7 TraesCS2D01G018900 chr5D 96.110 1234 46 2 1 1233 385494706 385493474 0.000000e+00 2012.0
8 TraesCS2D01G018900 chr3D 98.401 1563 22 3 1 1561 420457958 420459519 0.000000e+00 2745.0
9 TraesCS2D01G018900 chr3D 94.373 853 31 6 1452 2303 420459350 420460186 0.000000e+00 1293.0
10 TraesCS2D01G018900 chr2B 90.080 1633 113 22 1 1597 679648704 679647085 0.000000e+00 2073.0
11 TraesCS2D01G018900 chr2B 89.760 459 46 1 1384 1841 679647268 679646810 9.170000e-164 586.0
12 TraesCS2D01G018900 chr7A 94.860 1323 46 15 1 1306 483750174 483748857 0.000000e+00 2047.0
13 TraesCS2D01G018900 chr7A 91.572 1056 67 12 1268 2303 483748837 483747784 0.000000e+00 1437.0
14 TraesCS2D01G018900 chr6B 92.066 1336 77 15 1 1311 671654046 671652715 0.000000e+00 1853.0
15 TraesCS2D01G018900 chr6B 89.303 1234 128 4 2 1233 4276107 4277338 0.000000e+00 1544.0
16 TraesCS2D01G018900 chr6B 86.744 777 85 11 1335 2111 671649546 671648788 0.000000e+00 848.0
17 TraesCS2D01G018900 chr6B 94.872 156 7 1 2149 2303 671648785 671648630 2.290000e-60 243.0
18 TraesCS2D01G018900 chr7B 92.181 1036 64 3 1284 2303 659925849 659924815 0.000000e+00 1448.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G018900 chr2D 8945883 8948185 2302 False 4253.000000 4253 100.000000 1 2303 1 chr2D.!!$F1 2302
1 TraesCS2D01G018900 chr2D 536081822 536084124 2302 True 4043.000000 4043 98.351000 1 2303 1 chr2D.!!$R1 2302
2 TraesCS2D01G018900 chr2D 577707283 577708574 1291 True 2106.000000 2106 96.362000 1034 2303 1 chr2D.!!$R2 1269
3 TraesCS2D01G018900 chr2D 616988193 616990449 2256 False 1330.833333 3387 98.786333 1 2303 3 chr2D.!!$F2 2302
4 TraesCS2D01G018900 chr5D 357884351 357886631 2280 False 3923.000000 3923 97.569000 1 2303 1 chr5D.!!$F1 2302
5 TraesCS2D01G018900 chr5D 385493474 385494706 1232 True 2012.000000 2012 96.110000 1 1233 1 chr5D.!!$R1 1232
6 TraesCS2D01G018900 chr3D 420457958 420460186 2228 False 2019.000000 2745 96.387000 1 2303 2 chr3D.!!$F1 2302
7 TraesCS2D01G018900 chr2B 679646810 679648704 1894 True 1329.500000 2073 89.920000 1 1841 2 chr2B.!!$R1 1840
8 TraesCS2D01G018900 chr7A 483747784 483750174 2390 True 1742.000000 2047 93.216000 1 2303 2 chr7A.!!$R1 2302
9 TraesCS2D01G018900 chr6B 4276107 4277338 1231 False 1544.000000 1544 89.303000 2 1233 1 chr6B.!!$F1 1231
10 TraesCS2D01G018900 chr6B 671648630 671654046 5416 True 981.333333 1853 91.227333 1 2303 3 chr6B.!!$R1 2302
11 TraesCS2D01G018900 chr7B 659924815 659925849 1034 True 1448.000000 1448 92.181000 1284 2303 1 chr7B.!!$R1 1019

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
809 821 1.610522 CACTGGGAGAAAAAGGCAGTG 59.389 52.381 0.0 0.0 33.75 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1905 5258 3.051327 TGAGCATTTGCAAACAACATCG 58.949 40.909 15.41 0.0 45.16 3.84 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
717 729 5.984926 TCCAAGTGCATTCAAGAAATTGAAC 59.015 36.000 5.61 0.0 42.91 3.18
809 821 1.610522 CACTGGGAGAAAAAGGCAGTG 59.389 52.381 0.00 0.0 33.75 3.66
1414 4767 1.617850 CTGGCCCAACAACAGCATTTA 59.382 47.619 0.00 0.0 0.00 1.40
1654 5007 1.837439 CACAACCTGGGCCATCTACTA 59.163 52.381 6.72 0.0 0.00 1.82
2144 5561 9.690913 ATCCATACATATAATTGGAATGACAGG 57.309 33.333 4.36 0.0 41.36 4.00
2264 5684 4.942761 AACCAAGCACAAAGACAATCAT 57.057 36.364 0.00 0.0 0.00 2.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
346 352 3.454858 TGTTCCCTATGCTTCTTCCTCT 58.545 45.455 0.00 0.00 0.00 3.69
625 637 6.943718 TGAATTCTAACCATAACCGTTTTCCT 59.056 34.615 7.05 0.00 0.00 3.36
627 639 7.120138 TCCTGAATTCTAACCATAACCGTTTTC 59.880 37.037 7.05 0.00 0.00 2.29
632 644 5.878116 TGTTCCTGAATTCTAACCATAACCG 59.122 40.000 7.05 0.00 0.00 4.44
717 729 2.161855 TGGGTTCTTGCTATGCTGTTG 58.838 47.619 0.00 0.00 0.00 3.33
809 821 2.286294 CAGTTGTCAAGACTCACTGTGC 59.714 50.000 17.72 0.00 37.95 4.57
1204 1220 5.365314 TCTTTTTGCCTCTGTATGGGTTTTT 59.635 36.000 0.00 0.00 0.00 1.94
1654 5007 6.581712 CAGGAGCTCTTTTTCTCTTATAGCT 58.418 40.000 14.64 0.00 41.29 3.32
1791 5144 3.657727 ACCATAGCCTTAATATGCCTGGT 59.342 43.478 0.00 9.18 38.49 4.00
1905 5258 3.051327 TGAGCATTTGCAAACAACATCG 58.949 40.909 15.41 0.00 45.16 3.84
2127 5522 8.759481 TGCAATTACCTGTCATTCCAATTATA 57.241 30.769 0.00 0.00 0.00 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.