Multiple sequence alignment - TraesCS2D01G008100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G008100 chr2D 100.000 2543 0 0 1 2543 4386564 4389106 0.000000e+00 4697
1 TraesCS2D01G008100 chr2D 99.410 2544 14 1 1 2543 4329846 4332389 0.000000e+00 4614
2 TraesCS2D01G008100 chr2D 99.363 2511 15 1 1 2510 4355040 4357550 0.000000e+00 4547
3 TraesCS2D01G008100 chr2D 84.027 1033 110 32 821 1842 4318093 4319081 0.000000e+00 942
4 TraesCS2D01G008100 chr2D 84.470 689 77 20 1158 1842 4343393 4344055 0.000000e+00 652
5 TraesCS2D01G008100 chr2D 84.470 689 77 19 1158 1842 4375143 4375805 0.000000e+00 652
6 TraesCS2D01G008100 chr2B 91.317 1025 81 6 824 1843 6727598 6726577 0.000000e+00 1393
7 TraesCS2D01G008100 chr2B 86.641 1033 99 15 814 1832 6765308 6764301 0.000000e+00 1107
8 TraesCS2D01G008100 chr2B 86.615 1031 99 15 814 1830 6813244 6812239 0.000000e+00 1103
9 TraesCS2D01G008100 chr2B 86.544 1033 100 15 814 1832 6900720 6899713 0.000000e+00 1101
10 TraesCS2D01G008100 chr2B 92.197 487 37 1 327 813 6728175 6727690 0.000000e+00 688
11 TraesCS2D01G008100 chr2B 91.152 486 42 1 327 812 6765887 6765403 0.000000e+00 658
12 TraesCS2D01G008100 chr2B 91.152 486 42 1 327 812 6813823 6813339 0.000000e+00 658
13 TraesCS2D01G008100 chr2B 90.928 485 43 1 328 812 6901298 6900815 0.000000e+00 651
14 TraesCS2D01G008100 chr2B 90.361 249 22 2 1 249 6766188 6765942 2.440000e-85 326
15 TraesCS2D01G008100 chr2B 89.960 249 23 2 1 249 6814124 6813878 1.140000e-83 320
16 TraesCS2D01G008100 chr2B 89.960 249 23 2 1 249 6901600 6901354 1.140000e-83 320
17 TraesCS2D01G008100 chr2B 89.558 249 24 2 1 249 6728476 6728230 5.280000e-82 315
18 TraesCS2D01G008100 chr2B 76.569 239 47 7 1 236 454725040 454725272 3.440000e-24 122
19 TraesCS2D01G008100 chrUn 84.221 1033 108 32 821 1842 316738714 316739702 0.000000e+00 953
20 TraesCS2D01G008100 chrUn 76.569 239 47 7 1 236 268875902 268876134 3.440000e-24 122
21 TraesCS2D01G008100 chrUn 76.569 239 47 7 1 236 424079246 424079478 3.440000e-24 122
22 TraesCS2D01G008100 chr3D 92.560 336 17 5 2213 2543 553930773 553931105 2.290000e-130 475
23 TraesCS2D01G008100 chr5D 90.698 258 24 0 2217 2474 133163762 133164019 6.740000e-91 344
24 TraesCS2D01G008100 chr7B 89.888 267 26 1 2217 2483 748602453 748602718 2.420000e-90 342
25 TraesCS2D01G008100 chr6D 88.693 283 29 2 2217 2497 443237875 443238156 2.420000e-90 342
26 TraesCS2D01G008100 chr4A 89.804 255 25 1 2217 2471 34551411 34551158 2.440000e-85 326
27 TraesCS2D01G008100 chr4A 85.209 311 39 5 2217 2524 214197590 214197896 1.900000e-81 313
28 TraesCS2D01G008100 chr4A 84.277 318 39 6 2217 2532 214200000 214200308 1.480000e-77 300


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G008100 chr2D 4386564 4389106 2542 False 4697.000000 4697 100.000000 1 2543 1 chr2D.!!$F6 2542
1 TraesCS2D01G008100 chr2D 4329846 4332389 2543 False 4614.000000 4614 99.410000 1 2543 1 chr2D.!!$F2 2542
2 TraesCS2D01G008100 chr2D 4355040 4357550 2510 False 4547.000000 4547 99.363000 1 2510 1 chr2D.!!$F4 2509
3 TraesCS2D01G008100 chr2D 4318093 4319081 988 False 942.000000 942 84.027000 821 1842 1 chr2D.!!$F1 1021
4 TraesCS2D01G008100 chr2D 4343393 4344055 662 False 652.000000 652 84.470000 1158 1842 1 chr2D.!!$F3 684
5 TraesCS2D01G008100 chr2D 4375143 4375805 662 False 652.000000 652 84.470000 1158 1842 1 chr2D.!!$F5 684
6 TraesCS2D01G008100 chr2B 6726577 6728476 1899 True 798.666667 1393 91.024000 1 1843 3 chr2B.!!$R1 1842
7 TraesCS2D01G008100 chr2B 6764301 6766188 1887 True 697.000000 1107 89.384667 1 1832 3 chr2B.!!$R2 1831
8 TraesCS2D01G008100 chr2B 6812239 6814124 1885 True 693.666667 1103 89.242333 1 1830 3 chr2B.!!$R3 1829
9 TraesCS2D01G008100 chr2B 6899713 6901600 1887 True 690.666667 1101 89.144000 1 1832 3 chr2B.!!$R4 1831
10 TraesCS2D01G008100 chrUn 316738714 316739702 988 False 953.000000 953 84.221000 821 1842 1 chrUn.!!$F2 1021
11 TraesCS2D01G008100 chr4A 214197590 214200308 2718 False 306.500000 313 84.743000 2217 2532 2 chr4A.!!$F1 315

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
26 27 1.821753 CTGATGTTCCTCAGACTCGGT 59.178 52.381 0.0 0.0 44.48 4.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2300 2413 1.902918 ACACGCCTACACCACGGTA 60.903 57.895 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 1.821753 CTGATGTTCCTCAGACTCGGT 59.178 52.381 0.00 0.00 44.48 4.69
669 670 4.820173 GCATCATCTCCAACATCATTGAGA 59.180 41.667 0.00 0.00 0.00 3.27
2258 2371 4.678269 CAGTGTCGGACGCGTCGT 62.678 66.667 30.99 9.77 45.10 4.34
2414 2527 3.220658 TCGGATATGCGCGGGACA 61.221 61.111 12.27 0.00 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
940 1040 5.251700 ACTCCAATGTTATTCCAGAGGTCTT 59.748 40.000 0.0 0.0 0.0 3.01
2300 2413 1.902918 ACACGCCTACACCACGGTA 60.903 57.895 0.0 0.0 0.0 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.