Multiple sequence alignment - TraesCS2D01G007400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G007400 chr2D 100.000 3751 0 0 1 3751 4029900 4033650 0.000000e+00 6927.0
1 TraesCS2D01G007400 chr2D 97.925 2891 40 3 861 3751 3973462 3976332 0.000000e+00 4988.0
2 TraesCS2D01G007400 chr2D 97.267 878 10 4 1 866 3972302 3973177 0.000000e+00 1476.0
3 TraesCS2D01G007400 chr2D 82.353 119 14 6 136 251 60072525 60072639 3.080000e-16 97.1
4 TraesCS2D01G007400 chr2D 95.556 45 2 0 626 670 3972882 3972926 5.200000e-09 73.1
5 TraesCS2D01G007400 chr2D 95.556 45 2 0 626 670 4030481 4030525 5.200000e-09 73.1
6 TraesCS2D01G007400 chr2B 87.754 2809 238 49 864 3592 6960839 6963621 0.000000e+00 3184.0
7 TraesCS2D01G007400 chr2B 89.097 2504 182 42 859 3292 7082960 7080478 0.000000e+00 3027.0
8 TraesCS2D01G007400 chr2B 89.076 2499 184 43 864 3292 7157203 7154724 0.000000e+00 3020.0
9 TraesCS2D01G007400 chr2B 89.009 2502 187 39 861 3292 454724696 454727179 0.000000e+00 3016.0
10 TraesCS2D01G007400 chr2B 90.586 2305 165 22 864 3127 7124638 7122345 0.000000e+00 3007.0
11 TraesCS2D01G007400 chr2B 88.658 2504 191 40 864 3292 7044146 7041661 0.000000e+00 2964.0
12 TraesCS2D01G007400 chr2B 90.208 2308 164 22 861 3127 454788831 454791117 0.000000e+00 2953.0
13 TraesCS2D01G007400 chr2B 92.004 1876 130 9 864 2725 6874881 6876750 0.000000e+00 2615.0
14 TraesCS2D01G007400 chr2B 94.643 560 25 4 1 557 454694749 454695306 0.000000e+00 863.0
15 TraesCS2D01G007400 chr2B 95.854 410 16 1 204 613 454788079 454788487 0.000000e+00 662.0
16 TraesCS2D01G007400 chr2B 95.400 413 18 1 207 619 7044898 7044487 0.000000e+00 656.0
17 TraesCS2D01G007400 chr2B 95.400 413 18 1 207 619 7157955 7157544 0.000000e+00 656.0
18 TraesCS2D01G007400 chr2B 95.610 410 17 1 204 613 454723944 454724352 0.000000e+00 656.0
19 TraesCS2D01G007400 chr2B 94.431 413 22 1 207 619 7083707 7083296 5.290000e-178 634.0
20 TraesCS2D01G007400 chr2B 79.292 932 107 40 2727 3592 6882300 6883211 1.170000e-159 573.0
21 TraesCS2D01G007400 chrUn 91.266 1122 86 5 861 1970 268875558 268876679 0.000000e+00 1519.0
22 TraesCS2D01G007400 chrUn 84.557 790 79 29 8 761 11581646 11580864 0.000000e+00 743.0
23 TraesCS2D01G007400 chrUn 95.854 410 16 1 204 613 360049479 360049887 0.000000e+00 662.0
24 TraesCS2D01G007400 chrUn 95.610 410 17 1 204 613 268874806 268875214 0.000000e+00 656.0
25 TraesCS2D01G007400 chrUn 96.552 87 3 0 671 757 268875214 268875300 1.090000e-30 145.0
26 TraesCS2D01G007400 chrUn 96.552 87 3 0 671 757 360049887 360049973 1.090000e-30 145.0
27 TraesCS2D01G007400 chrUn 96.552 87 3 0 671 757 424078558 424078644 1.090000e-30 145.0
28 TraesCS2D01G007400 chrUn 88.158 76 7 2 790 865 380190604 380190677 5.160000e-14 89.8
29 TraesCS2D01G007400 chrUn 81.720 93 5 8 775 866 43399953 43400034 2.420000e-07 67.6
30 TraesCS2D01G007400 chrUn 100.000 34 0 0 626 659 268875183 268875216 3.130000e-06 63.9
31 TraesCS2D01G007400 chrUn 100.000 34 0 0 626 659 360049856 360049889 3.130000e-06 63.9
32 TraesCS2D01G007400 chrUn 100.000 34 0 0 626 659 424078527 424078560 3.130000e-06 63.9
33 TraesCS2D01G007400 chrUn 100.000 30 0 0 773 802 76852843 76852872 5.230000e-04 56.5
34 TraesCS2D01G007400 chr4A 96.774 62 2 0 805 866 618125573 618125512 1.840000e-18 104.0
35 TraesCS2D01G007400 chr5D 73.476 328 57 25 82 389 288573994 288573677 3.080000e-16 97.1
36 TraesCS2D01G007400 chr5D 94.595 37 2 0 771 807 542392719 542392683 1.460000e-04 58.4
37 TraesCS2D01G007400 chr7B 81.301 123 16 7 119 237 707593345 707593226 3.990000e-15 93.5
38 TraesCS2D01G007400 chr7B 88.158 76 7 2 790 865 23741924 23741997 5.160000e-14 89.8
39 TraesCS2D01G007400 chr7B 88.158 76 7 2 790 865 23803590 23803663 5.160000e-14 89.8
40 TraesCS2D01G007400 chr1B 91.803 61 5 0 805 865 593449304 593449244 6.680000e-13 86.1
41 TraesCS2D01G007400 chr6D 94.545 55 2 1 813 866 468605593 468605539 2.400000e-12 84.2
42 TraesCS2D01G007400 chr6D 96.970 33 1 0 775 807 10924523 10924555 5.230000e-04 56.5
43 TraesCS2D01G007400 chr5B 72.816 309 56 24 99 389 523363126 523362828 3.110000e-11 80.5
44 TraesCS2D01G007400 chr3A 73.152 257 50 13 146 391 115610576 115610824 1.440000e-09 75.0
45 TraesCS2D01G007400 chr1A 90.909 44 4 0 822 865 534434670 534434627 4.050000e-05 60.2
46 TraesCS2D01G007400 chr1A 97.059 34 0 1 770 802 583115648 583115615 5.230000e-04 56.5
47 TraesCS2D01G007400 chr7D 97.143 35 0 1 805 838 28214905 28214871 1.460000e-04 58.4
48 TraesCS2D01G007400 chr7D 97.059 34 1 0 774 807 601400929 601400896 1.460000e-04 58.4
49 TraesCS2D01G007400 chr2A 100.000 31 0 0 773 803 205254845 205254875 1.460000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G007400 chr2D 4029900 4033650 3750 False 3500.050000 6927 97.7780 1 3751 2 chr2D.!!$F3 3750
1 TraesCS2D01G007400 chr2D 3972302 3976332 4030 False 2179.033333 4988 96.9160 1 3751 3 chr2D.!!$F2 3750
2 TraesCS2D01G007400 chr2B 6960839 6963621 2782 False 3184.000000 3184 87.7540 864 3592 1 chr2B.!!$F3 2728
3 TraesCS2D01G007400 chr2B 7122345 7124638 2293 True 3007.000000 3007 90.5860 864 3127 1 chr2B.!!$R1 2263
4 TraesCS2D01G007400 chr2B 6874881 6876750 1869 False 2615.000000 2615 92.0040 864 2725 1 chr2B.!!$F1 1861
5 TraesCS2D01G007400 chr2B 7154724 7157955 3231 True 1838.000000 3020 92.2380 207 3292 2 chr2B.!!$R4 3085
6 TraesCS2D01G007400 chr2B 454723944 454727179 3235 False 1836.000000 3016 92.3095 204 3292 2 chr2B.!!$F5 3088
7 TraesCS2D01G007400 chr2B 7080478 7083707 3229 True 1830.500000 3027 91.7640 207 3292 2 chr2B.!!$R3 3085
8 TraesCS2D01G007400 chr2B 7041661 7044898 3237 True 1810.000000 2964 92.0290 207 3292 2 chr2B.!!$R2 3085
9 TraesCS2D01G007400 chr2B 454788079 454791117 3038 False 1807.500000 2953 93.0310 204 3127 2 chr2B.!!$F6 2923
10 TraesCS2D01G007400 chr2B 454694749 454695306 557 False 863.000000 863 94.6430 1 557 1 chr2B.!!$F4 556
11 TraesCS2D01G007400 chr2B 6882300 6883211 911 False 573.000000 573 79.2920 2727 3592 1 chr2B.!!$F2 865
12 TraesCS2D01G007400 chrUn 11580864 11581646 782 True 743.000000 743 84.5570 8 761 1 chrUn.!!$R1 753
13 TraesCS2D01G007400 chrUn 268874806 268876679 1873 False 595.975000 1519 95.8570 204 1970 4 chrUn.!!$F4 1766

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
506 539 0.534873 ACAAGTTGTTTTTGCCGCCT 59.465 45.000 1.64 0.0 0.0 5.52 F
1333 1787 1.078918 CTGGACATCTTCGGCTGCA 60.079 57.895 0.50 0.0 0.0 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2189 2645 1.294138 GGTTTCGGGATGACGGACA 59.706 57.895 0.00 0.0 0.0 4.02 R
3135 3649 2.867109 AGCATGCCAAGACAGTAACT 57.133 45.000 15.66 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 211 2.432456 GTGCGAGATGTCCGTGCA 60.432 61.111 0.00 0.00 0.00 4.57
500 533 9.264782 CTTCAAAAAGCATACAAGTTGTTTTTG 57.735 29.630 24.21 24.21 42.31 2.44
506 539 0.534873 ACAAGTTGTTTTTGCCGCCT 59.465 45.000 1.64 0.00 0.00 5.52
631 668 1.966451 CGTTTGGGCCGCTTTCTCT 60.966 57.895 0.00 0.00 0.00 3.10
662 699 5.447010 GCTGCTAGCTGAGTATGAAAGTTTG 60.447 44.000 24.19 0.00 38.45 2.93
745 841 4.803452 ACTCCACCTTCTCCATTTCAAAA 58.197 39.130 0.00 0.00 0.00 2.44
923 1359 2.836372 AGCCAGTTCATGAGTCATCAGA 59.164 45.455 1.56 0.00 39.29 3.27
1060 1513 1.612199 CGCTAGTGGCCCTTTGGTTTA 60.612 52.381 0.00 0.00 37.74 2.01
1333 1787 1.078918 CTGGACATCTTCGGCTGCA 60.079 57.895 0.50 0.00 0.00 4.41
1427 1881 2.144952 TCAGCTCCAAGCAGGTGAA 58.855 52.632 1.53 0.00 45.67 3.18
1551 2005 1.372499 GCTCAGCAACGACGTGGTA 60.372 57.895 2.83 0.00 0.00 3.25
1988 2442 7.453126 TGCAAAAAGAAAACCCCTAGATTCATA 59.547 33.333 0.00 0.00 0.00 2.15
2189 2645 3.720601 TGGGCGATGGCTGAGCTT 61.721 61.111 3.72 0.00 39.81 3.74
2720 3181 9.574516 AGAAAATATGACCTACAATTGATACCC 57.425 33.333 13.59 0.00 0.00 3.69
2785 3246 6.112927 TGTGCATTGCCTCATAGATATGTA 57.887 37.500 6.12 0.00 35.26 2.29
3233 3747 3.157881 TGACACACTGGTTTGGTTTTCA 58.842 40.909 0.00 0.00 0.00 2.69
3292 3808 6.647334 TTATGAATCAAAAGGAAGTGTGCA 57.353 33.333 0.00 0.00 0.00 4.57
3592 4114 1.730902 CCTCACTCAGTGTGTCGCG 60.731 63.158 4.28 0.00 46.27 5.87
3611 4133 2.164427 CGTAGCGACACGTCTTAAGTC 58.836 52.381 1.63 0.00 37.16 3.01
3703 4225 3.126831 ACTCGATAGTGCTGCTTAATGC 58.873 45.455 0.00 0.00 37.02 3.56
3743 4265 7.254319 CGCTAACAAATAGTATGGTACCACTTG 60.254 40.741 19.09 15.12 33.87 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 211 7.936496 AAATGTCCAAACTTCACCAAATTTT 57.064 28.000 0.00 0.00 0.00 1.82
389 402 2.743183 GCTTCACCACATAGCTTCCGAT 60.743 50.000 0.00 0.00 32.26 4.18
500 533 5.701290 AGTATTAAAAGATACATCAGGCGGC 59.299 40.000 0.00 0.00 35.43 6.53
631 668 1.349026 ACTCAGCTAGCAGCCAGAAAA 59.651 47.619 18.83 0.00 43.77 2.29
662 699 3.192466 CAATTTGCAATCTTAGCAGCCC 58.808 45.455 0.00 0.00 43.75 5.19
821 956 5.856126 TTTTAAATAGCGCGCTATAGCAT 57.144 34.783 43.81 32.14 42.21 3.79
1439 1893 2.192443 CCTGCTCTGGCCTGATGG 59.808 66.667 13.33 11.59 37.74 3.51
2189 2645 1.294138 GGTTTCGGGATGACGGACA 59.706 57.895 0.00 0.00 0.00 4.02
2743 3204 7.486407 TGCACATCCATCTATGACTATATGT 57.514 36.000 0.00 0.00 0.00 2.29
3026 3513 4.528596 TCCAAAAGGACACAAAAGAAACCA 59.471 37.500 0.00 0.00 0.00 3.67
3027 3514 5.079689 TCCAAAAGGACACAAAAGAAACC 57.920 39.130 0.00 0.00 0.00 3.27
3135 3649 2.867109 AGCATGCCAAGACAGTAACT 57.133 45.000 15.66 0.00 0.00 2.24
3233 3747 9.588096 AGTTTATTTTATGAGGAAAGTTGGTCT 57.412 29.630 0.00 0.00 0.00 3.85
3389 3906 8.740123 ATAGAGTCTCAATATAGTGGATACGG 57.260 38.462 0.00 0.00 42.51 4.02
3592 4114 2.907392 GTGACTTAAGACGTGTCGCTAC 59.093 50.000 10.09 0.00 37.97 3.58
3611 4133 4.530388 CCATGCAATTAAGTCGCTATGTG 58.470 43.478 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.