Multiple sequence alignment - TraesCS2D01G003000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G003000 chr2D 100.000 2707 0 0 1 2707 2221613 2224319 0.000000e+00 5000.0
1 TraesCS2D01G003000 chr2D 94.562 1508 60 9 752 2241 2516272 2514769 0.000000e+00 2311.0
2 TraesCS2D01G003000 chr2D 89.521 334 31 2 2367 2696 2514535 2514202 1.160000e-113 420.0
3 TraesCS2D01G003000 chr2D 81.944 288 45 5 890 1170 634921124 634921411 1.250000e-58 237.0
4 TraesCS2D01G003000 chr2D 95.455 44 2 0 717 760 81528117 81528160 1.340000e-08 71.3
5 TraesCS2D01G003000 chr2A 92.843 1970 107 14 756 2707 2402507 2404460 0.000000e+00 2826.0
6 TraesCS2D01G003000 chr2A 76.215 967 183 30 860 1794 777785915 777786866 4.080000e-128 468.0
7 TraesCS2D01G003000 chrUn 91.992 1024 45 12 1700 2707 15862421 15863423 0.000000e+00 1402.0
8 TraesCS2D01G003000 chrUn 93.011 973 46 10 756 1711 15859903 15860870 0.000000e+00 1400.0
9 TraesCS2D01G003000 chrUn 83.867 750 97 20 21 758 47848489 47849226 0.000000e+00 693.0
10 TraesCS2D01G003000 chrUn 83.459 266 30 7 1805 2059 48578413 48578151 4.510000e-58 235.0
11 TraesCS2D01G003000 chr1D 86.272 743 72 17 1 724 15157626 15156895 0.000000e+00 780.0
12 TraesCS2D01G003000 chr1D 84.848 660 80 15 53 706 66420541 66419896 0.000000e+00 647.0
13 TraesCS2D01G003000 chr4A 86.555 714 77 16 13 721 73550351 73551050 0.000000e+00 769.0
14 TraesCS2D01G003000 chr7D 86.798 712 63 19 30 724 454653904 454654601 0.000000e+00 765.0
15 TraesCS2D01G003000 chr7D 87.284 637 62 10 89 724 303856605 303857223 0.000000e+00 710.0
16 TraesCS2D01G003000 chr7D 92.075 429 30 2 297 724 584245243 584245668 3.860000e-168 601.0
17 TraesCS2D01G003000 chr7D 83.333 264 30 7 1809 2061 606764917 606765177 5.830000e-57 231.0
18 TraesCS2D01G003000 chr7D 83.721 86 14 0 2242 2327 591566231 591566146 6.210000e-12 82.4
19 TraesCS2D01G003000 chr5D 86.390 698 69 15 40 724 237850813 237850129 0.000000e+00 739.0
20 TraesCS2D01G003000 chr5D 92.671 423 28 1 305 724 509619877 509620299 8.290000e-170 606.0
21 TraesCS2D01G003000 chr5D 84.375 64 10 0 2242 2305 103611834 103611897 2.250000e-06 63.9
22 TraesCS2D01G003000 chr5B 85.816 705 69 18 40 724 642367023 642366330 0.000000e+00 719.0
23 TraesCS2D01G003000 chr5B 82.227 422 50 18 1 404 607298242 607298656 9.280000e-90 340.0
24 TraesCS2D01G003000 chr5A 82.740 759 99 20 17 757 701389130 701389874 0.000000e+00 647.0
25 TraesCS2D01G003000 chr5A 84.488 664 83 13 62 713 689365087 689365742 2.940000e-179 638.0
26 TraesCS2D01G003000 chr5A 77.442 563 83 27 1536 2070 432930017 432930563 2.040000e-76 296.0
27 TraesCS2D01G003000 chr5A 95.238 42 2 0 716 757 594907818 594907777 1.740000e-07 67.6
28 TraesCS2D01G003000 chr2B 78.438 589 90 24 859 1434 777653557 777652993 1.540000e-92 350.0
29 TraesCS2D01G003000 chr3A 77.500 560 88 25 1539 2070 42133992 42133443 4.380000e-78 302.0
30 TraesCS2D01G003000 chr3A 77.321 560 89 25 1539 2070 42105080 42104531 2.040000e-76 296.0
31 TraesCS2D01G003000 chr3A 77.224 562 85 30 1539 2070 42075904 42075356 3.410000e-74 289.0
32 TraesCS2D01G003000 chr1B 80.528 303 47 8 61 356 7082556 7082259 3.510000e-54 222.0
33 TraesCS2D01G003000 chr1B 90.625 64 5 1 2242 2305 344310892 344310830 1.730000e-12 84.2
34 TraesCS2D01G003000 chr1B 80.682 88 17 0 2242 2329 647240775 647240862 4.840000e-08 69.4
35 TraesCS2D01G003000 chr4B 81.818 88 16 0 2242 2329 61520343 61520430 1.040000e-09 75.0
36 TraesCS2D01G003000 chr3D 81.915 94 12 4 2238 2328 109305763 109305672 1.040000e-09 75.0
37 TraesCS2D01G003000 chr7A 81.395 86 16 0 2242 2327 682023227 682023142 1.340000e-08 71.3
38 TraesCS2D01G003000 chr7A 89.583 48 5 0 717 764 77588964 77589011 8.090000e-06 62.1
39 TraesCS2D01G003000 chr7B 95.349 43 2 0 717 759 473313223 473313265 4.840000e-08 69.4
40 TraesCS2D01G003000 chr7B 95.238 42 2 0 717 758 691971976 691971935 1.740000e-07 67.6
41 TraesCS2D01G003000 chr7B 91.667 48 4 0 711 758 692005376 692005329 1.740000e-07 67.6
42 TraesCS2D01G003000 chr4D 84.507 71 9 2 689 758 253946225 253946294 4.840000e-08 69.4
43 TraesCS2D01G003000 chr3B 95.122 41 2 0 717 757 552443702 552443662 6.260000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G003000 chr2D 2221613 2224319 2706 False 5000.0 5000 100.0000 1 2707 1 chr2D.!!$F1 2706
1 TraesCS2D01G003000 chr2D 2514202 2516272 2070 True 1365.5 2311 92.0415 752 2696 2 chr2D.!!$R1 1944
2 TraesCS2D01G003000 chr2A 2402507 2404460 1953 False 2826.0 2826 92.8430 756 2707 1 chr2A.!!$F1 1951
3 TraesCS2D01G003000 chr2A 777785915 777786866 951 False 468.0 468 76.2150 860 1794 1 chr2A.!!$F2 934
4 TraesCS2D01G003000 chrUn 15859903 15863423 3520 False 1401.0 1402 92.5015 756 2707 2 chrUn.!!$F2 1951
5 TraesCS2D01G003000 chrUn 47848489 47849226 737 False 693.0 693 83.8670 21 758 1 chrUn.!!$F1 737
6 TraesCS2D01G003000 chr1D 15156895 15157626 731 True 780.0 780 86.2720 1 724 1 chr1D.!!$R1 723
7 TraesCS2D01G003000 chr1D 66419896 66420541 645 True 647.0 647 84.8480 53 706 1 chr1D.!!$R2 653
8 TraesCS2D01G003000 chr4A 73550351 73551050 699 False 769.0 769 86.5550 13 721 1 chr4A.!!$F1 708
9 TraesCS2D01G003000 chr7D 454653904 454654601 697 False 765.0 765 86.7980 30 724 1 chr7D.!!$F2 694
10 TraesCS2D01G003000 chr7D 303856605 303857223 618 False 710.0 710 87.2840 89 724 1 chr7D.!!$F1 635
11 TraesCS2D01G003000 chr5D 237850129 237850813 684 True 739.0 739 86.3900 40 724 1 chr5D.!!$R1 684
12 TraesCS2D01G003000 chr5B 642366330 642367023 693 True 719.0 719 85.8160 40 724 1 chr5B.!!$R1 684
13 TraesCS2D01G003000 chr5A 701389130 701389874 744 False 647.0 647 82.7400 17 757 1 chr5A.!!$F3 740
14 TraesCS2D01G003000 chr5A 689365087 689365742 655 False 638.0 638 84.4880 62 713 1 chr5A.!!$F2 651
15 TraesCS2D01G003000 chr5A 432930017 432930563 546 False 296.0 296 77.4420 1536 2070 1 chr5A.!!$F1 534
16 TraesCS2D01G003000 chr2B 777652993 777653557 564 True 350.0 350 78.4380 859 1434 1 chr2B.!!$R1 575
17 TraesCS2D01G003000 chr3A 42133443 42133992 549 True 302.0 302 77.5000 1539 2070 1 chr3A.!!$R3 531
18 TraesCS2D01G003000 chr3A 42104531 42105080 549 True 296.0 296 77.3210 1539 2070 1 chr3A.!!$R2 531
19 TraesCS2D01G003000 chr3A 42075356 42075904 548 True 289.0 289 77.2240 1539 2070 1 chr3A.!!$R1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
502 553 0.175989 GGAGCGAGGTGGGACTAAAG 59.824 60.000 0.0 0.0 0.0 1.85 F
964 1019 1.067071 GCTCGCCCTATATAAACGCCT 60.067 52.381 0.0 0.0 0.0 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1537 1618 0.107456 CTGTGATGGGAGGCGCTAAT 59.893 55.0 7.64 0.0 0.00 1.73 R
2310 4007 0.108138 GTAGCCACCGAGCAACAGAT 60.108 55.0 0.00 0.0 34.23 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 235 4.725169 GCAGTAGCGCTTTAGATGAACAAC 60.725 45.833 18.68 2.15 0.00 3.32
275 297 2.030981 CCAGCGCTACTACTAAGGCTAC 60.031 54.545 10.99 0.00 0.00 3.58
276 298 2.879646 CAGCGCTACTACTAAGGCTACT 59.120 50.000 10.99 0.00 0.00 2.57
277 299 2.879646 AGCGCTACTACTAAGGCTACTG 59.120 50.000 8.99 0.00 0.00 2.74
278 300 2.605097 GCGCTACTACTAAGGCTACTGC 60.605 54.545 0.00 0.00 38.76 4.40
279 301 2.879646 CGCTACTACTAAGGCTACTGCT 59.120 50.000 0.00 0.00 39.59 4.24
280 302 4.063689 CGCTACTACTAAGGCTACTGCTA 58.936 47.826 0.00 0.00 39.59 3.49
281 303 4.696402 CGCTACTACTAAGGCTACTGCTAT 59.304 45.833 0.00 0.00 39.59 2.97
431 481 5.808366 AGAGTACAATGAAGACCAAGTGA 57.192 39.130 0.00 0.00 0.00 3.41
502 553 0.175989 GGAGCGAGGTGGGACTAAAG 59.824 60.000 0.00 0.00 0.00 1.85
512 563 4.661709 AGGTGGGACTAAAGTTTGGTCTTA 59.338 41.667 25.54 15.15 40.56 2.10
637 688 1.972198 CCTACCTGCAACGGTCTGA 59.028 57.895 0.00 0.00 38.49 3.27
652 703 7.703621 GCAACGGTCTGACAATTATAGTAGTAA 59.296 37.037 10.38 0.00 0.00 2.24
724 775 1.896220 TTGCCCAAGAACTACTGCTG 58.104 50.000 0.00 0.00 0.00 4.41
741 792 2.159043 TGCTGAGCTCCTGTGTATAAGC 60.159 50.000 12.15 10.47 34.95 3.09
742 793 2.159043 GCTGAGCTCCTGTGTATAAGCA 60.159 50.000 12.15 0.00 37.22 3.91
751 802 6.569127 TCCTGTGTATAAGCATTTCCCTAA 57.431 37.500 0.00 0.00 0.00 2.69
797 848 9.276791 AGATTGGATATTGGATAGATAGAGCAA 57.723 33.333 0.00 0.00 0.00 3.91
834 885 7.391148 AGTAAACGAACCAATTCATGCTATT 57.609 32.000 0.00 0.00 34.14 1.73
963 1018 1.337447 TGCTCGCCCTATATAAACGCC 60.337 52.381 0.00 0.00 0.00 5.68
964 1019 1.067071 GCTCGCCCTATATAAACGCCT 60.067 52.381 0.00 0.00 0.00 5.52
973 1028 3.896648 ATATAAACGCCTGCAAATCGG 57.103 42.857 6.81 0.00 0.00 4.18
1228 1290 6.260050 GCACCTATGTTTGTAGCTAATAGCAA 59.740 38.462 15.28 0.00 45.56 3.91
1590 1677 3.489355 AGTCATCAACATGCCACTTTGA 58.511 40.909 0.00 0.00 33.89 2.69
1647 1738 2.767394 CCATGATTGCTCCCCATTTTCA 59.233 45.455 0.00 0.00 0.00 2.69
1648 1739 3.389983 CCATGATTGCTCCCCATTTTCAT 59.610 43.478 0.00 0.00 0.00 2.57
1679 1770 1.811266 CGCCTCTTGGGTCATGACG 60.811 63.158 19.33 5.97 37.43 4.35
1711 3364 1.820519 GCACCATGGATCATGTGTTGT 59.179 47.619 21.47 0.00 39.94 3.32
2081 3775 2.300723 TCTTTTGAAGCCATGCATTGCT 59.699 40.909 19.01 19.01 40.17 3.91
2110 3804 4.685169 ATAGTGCACCAAAGATCAAACG 57.315 40.909 14.63 0.00 0.00 3.60
2360 4202 1.592669 CGAGCCGATCCGATTTGCT 60.593 57.895 5.53 5.53 34.40 3.91
2363 4205 1.883084 GCCGATCCGATTTGCTCGT 60.883 57.895 0.00 0.00 46.18 4.18
2652 4498 1.734477 GCGTCTGATATGCGCGGAT 60.734 57.895 19.39 19.39 41.70 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
431 481 7.944729 ATGGTGCTTCTTAAACTATCACAAT 57.055 32.000 0.00 0.00 0.00 2.71
502 553 4.473922 AGTCCCCTCCTAATAAGACCAAAC 59.526 45.833 0.00 0.00 0.00 2.93
512 563 4.726825 TGCTAAATTCAGTCCCCTCCTAAT 59.273 41.667 0.00 0.00 0.00 1.73
652 703 2.921754 GCGCTGTAGATAGAAAACACGT 59.078 45.455 0.00 0.00 0.00 4.49
724 775 4.513318 GGAAATGCTTATACACAGGAGCTC 59.487 45.833 4.71 4.71 36.16 4.09
741 792 7.441157 TCGCATAGAAACACTATTAGGGAAATG 59.559 37.037 0.00 0.00 39.50 2.32
742 793 7.506114 TCGCATAGAAACACTATTAGGGAAAT 58.494 34.615 0.00 0.00 39.50 2.17
751 802 8.031864 CCAATCTAGATCGCATAGAAACACTAT 58.968 37.037 5.51 0.00 41.90 2.12
760 811 7.720442 TCCAATATCCAATCTAGATCGCATAG 58.280 38.462 5.51 0.00 0.00 2.23
812 863 8.952278 ACTTAATAGCATGAATTGGTTCGTTTA 58.048 29.630 0.00 0.00 37.15 2.01
834 885 5.191426 AGTACTTATCGCCTCACTGACTTA 58.809 41.667 0.00 0.00 0.00 2.24
963 1018 4.944962 TGATGAGTAAACCGATTTGCAG 57.055 40.909 0.00 0.00 33.20 4.41
964 1019 4.517075 TGTTGATGAGTAAACCGATTTGCA 59.483 37.500 0.00 0.00 33.20 4.08
973 1028 8.094798 TCTACCAAATGTGTTGATGAGTAAAC 57.905 34.615 0.00 0.00 0.00 2.01
1537 1618 0.107456 CTGTGATGGGAGGCGCTAAT 59.893 55.000 7.64 0.00 0.00 1.73
1543 1624 0.682209 ATGCAACTGTGATGGGAGGC 60.682 55.000 0.00 0.00 0.00 4.70
1647 1738 1.564348 AGAGGCGGAACCATGGTTTAT 59.436 47.619 30.33 9.71 43.14 1.40
1648 1739 0.988832 AGAGGCGGAACCATGGTTTA 59.011 50.000 30.33 0.00 43.14 2.01
1711 3364 1.001517 AGCTGAGTCAGAGGCGAGA 60.002 57.895 24.55 0.00 32.44 4.04
1814 3491 4.263506 ACATGCTTGTAGGGTTAGAAAGCT 60.264 41.667 2.92 0.00 33.16 3.74
2061 3755 2.695359 AGCAATGCATGGCTTCAAAAG 58.305 42.857 23.43 0.00 36.92 2.27
2081 3775 3.585289 TCTTTGGTGCACTATTCCCTGTA 59.415 43.478 17.98 0.00 0.00 2.74
2222 3919 5.062308 GGAGTATAATTTCCTAATGCGAGCG 59.938 44.000 0.00 0.00 0.00 5.03
2310 4007 0.108138 GTAGCCACCGAGCAACAGAT 60.108 55.000 0.00 0.00 34.23 2.90
2360 4202 1.332195 CCCTGATCTGAGCCATACGA 58.668 55.000 0.38 0.00 0.00 3.43
2363 4205 0.469892 TCGCCCTGATCTGAGCCATA 60.470 55.000 0.38 0.00 0.00 2.74
2566 4412 2.903547 GCTCGGAGGCGCTCTCTAG 61.904 68.421 20.47 18.29 42.10 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.