Multiple sequence alignment - TraesCS2B01G623800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G623800 chr2B 100.000 2462 0 0 1 2462 797244303 797241842 0.000000e+00 4547
1 TraesCS2B01G623800 chr3B 97.156 2215 51 5 248 2458 554035456 554037662 0.000000e+00 3731
2 TraesCS2B01G623800 chr3B 96.514 2209 49 6 252 2458 761578627 761580809 0.000000e+00 3627
3 TraesCS2B01G623800 chr3B 98.819 254 3 0 1 254 554032687 554032940 1.040000e-123 453
4 TraesCS2B01G623800 chr3B 97.638 254 5 1 1 254 761575855 761576107 3.760000e-118 435
5 TraesCS2B01G623800 chr7B 96.658 2214 59 6 248 2458 204160756 204162957 0.000000e+00 3664
6 TraesCS2B01G623800 chr7B 98.031 254 5 0 1 254 204157936 204158189 2.250000e-120 442
7 TraesCS2B01G623800 chr2A 95.982 2215 74 9 248 2458 4673450 4675653 0.000000e+00 3583
8 TraesCS2B01G623800 chr2A 95.276 254 11 1 1 254 4670759 4671011 3.810000e-108 401
9 TraesCS2B01G623800 chr5A 95.432 2211 85 8 252 2458 469302256 469304454 0.000000e+00 3509
10 TraesCS2B01G623800 chr5A 94.882 254 12 1 1 254 469299520 469299772 1.770000e-106 396
11 TraesCS2B01G623800 chr5A 91.286 241 19 2 1 239 542542984 542542744 6.560000e-86 327
12 TraesCS2B01G623800 chr1B 97.251 2001 44 4 461 2458 646679153 646677161 0.000000e+00 3380
13 TraesCS2B01G623800 chr1B 97.390 1609 31 4 852 2458 664599216 664600815 0.000000e+00 2728
14 TraesCS2B01G623800 chr1B 98.031 254 5 0 1 254 646679963 646679710 2.250000e-120 442
15 TraesCS2B01G623800 chr1B 96.457 254 7 1 1 254 664597457 664597708 3.790000e-113 418
16 TraesCS2B01G623800 chr6B 96.665 1889 51 6 573 2458 6501307 6499428 0.000000e+00 3129
17 TraesCS2B01G623800 chrUn 96.249 1493 44 6 337 1828 395861042 395862523 0.000000e+00 2436
18 TraesCS2B01G623800 chrUn 95.926 1080 32 4 248 1326 305557879 305556811 0.000000e+00 1740
19 TraesCS2B01G623800 chrUn 95.741 1080 34 4 248 1326 387693122 387692054 0.000000e+00 1729
20 TraesCS2B01G623800 chr7A 96.418 1061 35 3 1401 2458 19852356 19853416 0.000000e+00 1746
21 TraesCS2B01G623800 chr7A 96.667 360 9 2 249 607 19851026 19851383 1.630000e-166 595
22 TraesCS2B01G623800 chr6A 97.628 253 5 1 3 254 606596507 606596759 1.350000e-117 433


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G623800 chr2B 797241842 797244303 2461 True 4547.0 4547 100.0000 1 2462 1 chr2B.!!$R1 2461
1 TraesCS2B01G623800 chr3B 554032687 554037662 4975 False 2092.0 3731 97.9875 1 2458 2 chr3B.!!$F1 2457
2 TraesCS2B01G623800 chr3B 761575855 761580809 4954 False 2031.0 3627 97.0760 1 2458 2 chr3B.!!$F2 2457
3 TraesCS2B01G623800 chr7B 204157936 204162957 5021 False 2053.0 3664 97.3445 1 2458 2 chr7B.!!$F1 2457
4 TraesCS2B01G623800 chr2A 4670759 4675653 4894 False 1992.0 3583 95.6290 1 2458 2 chr2A.!!$F1 2457
5 TraesCS2B01G623800 chr5A 469299520 469304454 4934 False 1952.5 3509 95.1570 1 2458 2 chr5A.!!$F1 2457
6 TraesCS2B01G623800 chr1B 646677161 646679963 2802 True 1911.0 3380 97.6410 1 2458 2 chr1B.!!$R1 2457
7 TraesCS2B01G623800 chr1B 664597457 664600815 3358 False 1573.0 2728 96.9235 1 2458 2 chr1B.!!$F1 2457
8 TraesCS2B01G623800 chr6B 6499428 6501307 1879 True 3129.0 3129 96.6650 573 2458 1 chr6B.!!$R1 1885
9 TraesCS2B01G623800 chrUn 395861042 395862523 1481 False 2436.0 2436 96.2490 337 1828 1 chrUn.!!$F1 1491
10 TraesCS2B01G623800 chrUn 305556811 305557879 1068 True 1740.0 1740 95.9260 248 1326 1 chrUn.!!$R1 1078
11 TraesCS2B01G623800 chrUn 387692054 387693122 1068 True 1729.0 1729 95.7410 248 1326 1 chrUn.!!$R2 1078
12 TraesCS2B01G623800 chr7A 19851026 19853416 2390 False 1170.5 1746 96.5425 249 2458 2 chr7A.!!$F1 2209

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
964 3544 1.64571 AGAACAAGACCCGGTGAGAT 58.354 50.0 0.0 0.0 0.0 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2184 5025 7.034397 GCGACTTAATAGTTCTACCAAGAGTT 58.966 38.462 0.0 0.0 33.84 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
250 2828 7.817418 ATTCTGTTTGTTAGCTTTTACCTGA 57.183 32.000 0.00 0.00 0.00 3.86
257 2835 4.083003 TGTTAGCTTTTACCTGATTTGGCG 60.083 41.667 0.00 0.00 0.00 5.69
270 2848 3.063861 TGATTTGGCGATTGATGAAGTCG 59.936 43.478 0.00 0.00 38.34 4.18
383 2962 8.881262 CCCACTTGTAATATTCTCTATTACCCT 58.119 37.037 10.88 0.00 38.79 4.34
673 3253 6.834969 CCATATGCCATTATTCACCCATATGA 59.165 38.462 15.96 0.00 42.16 2.15
710 3290 7.526608 TGCATACTGTTGTTTACTAAGCATTC 58.473 34.615 0.00 0.00 0.00 2.67
840 3420 7.412853 CAATATTTAGAGTAAAGGCTGCTGTG 58.587 38.462 0.00 0.00 0.00 3.66
885 3465 8.784043 ACATAGCGACTTTATCCATTTTATTCC 58.216 33.333 0.00 0.00 0.00 3.01
964 3544 1.645710 AGAACAAGACCCGGTGAGAT 58.354 50.000 0.00 0.00 0.00 2.75
1329 3919 0.659957 GAGGAGATTCGCCAATGCAC 59.340 55.000 9.24 0.00 37.32 4.57
1595 4416 5.598005 TCAATTGGGGTTGCCATCTATTAAG 59.402 40.000 5.42 0.00 0.00 1.85
1686 4507 1.321805 TTCAATTGGGGCTGCCATCG 61.322 55.000 22.05 2.27 0.00 3.84
2071 4911 5.238214 GCAAGACTGAAGAGTTGAAGAACAT 59.762 40.000 0.00 0.00 34.17 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 1.673767 TCCCTCCTTCTGGCTTCATT 58.326 50.000 0.00 0.0 0.00 2.57
250 2828 2.355756 CCGACTTCATCAATCGCCAAAT 59.644 45.455 0.00 0.0 34.52 2.32
257 2835 3.932710 TGTAAGTGCCGACTTCATCAATC 59.067 43.478 0.00 0.0 41.75 2.67
270 2848 1.338769 ACGACATTCCCTGTAAGTGCC 60.339 52.381 0.00 0.0 38.54 5.01
383 2962 6.017934 GTGAGATGAACTGAGTTGCAAAACTA 60.018 38.462 0.90 0.0 32.22 2.24
673 3253 4.226427 ACAGTATGCAGGTGAATCATGT 57.774 40.909 0.00 0.0 42.53 3.21
809 3389 9.331282 CAGCCTTTACTCTAAATATTGCTAAGT 57.669 33.333 0.00 0.0 0.00 2.24
885 3465 5.462068 TCAGTCAATGACAACGAAGTACAAG 59.538 40.000 16.38 0.0 34.63 3.16
964 3544 7.851228 TCAACTTCCTTCTGCTTATCATTCTA 58.149 34.615 0.00 0.0 0.00 2.10
1329 3919 7.442062 ACTTGGCTTGTTAAATCCTTTTCAATG 59.558 33.333 0.00 0.0 0.00 2.82
1595 4416 4.515191 TCAAGTAGATGGCAGAAACAACAC 59.485 41.667 0.00 0.0 0.00 3.32
1686 4507 5.303971 AGTAGATGGCAGCAATAACTCATC 58.696 41.667 5.19 0.0 33.34 2.92
2071 4911 7.630242 AACAGAAAGTTCAATTCAGACTTCA 57.370 32.000 0.00 0.0 34.74 3.02
2184 5025 7.034397 GCGACTTAATAGTTCTACCAAGAGTT 58.966 38.462 0.00 0.0 33.84 3.01
2411 5253 7.386025 CAGAACAACAGATGAGTATTCAGAACA 59.614 37.037 0.00 0.0 36.61 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.