Multiple sequence alignment - TraesCS2B01G612800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G612800 chr2B 100.000 1972 0 0 1 1972 792039800 792041771 0.000000e+00 3642.0
1 TraesCS2B01G612800 chr2B 99.544 1972 9 0 1 1972 791956050 791958021 0.000000e+00 3592.0
2 TraesCS2B01G612800 chr2B 100.000 1516 0 0 2389 3904 792042188 792043703 0.000000e+00 2800.0
3 TraesCS2B01G612800 chr2B 99.538 1516 4 1 2389 3904 791958787 791960299 0.000000e+00 2758.0
4 TraesCS2B01G612800 chr2B 97.736 530 9 2 3209 3738 791980479 791981005 0.000000e+00 909.0
5 TraesCS2B01G612800 chr2B 96.014 276 9 2 2937 3212 791966111 791966384 7.690000e-122 448.0
6 TraesCS2B01G612800 chr2B 98.990 99 1 0 3806 3904 791981003 791981101 1.110000e-40 178.0
7 TraesCS2B01G612800 chr2B 78.261 230 45 4 2447 2675 704292567 704292792 4.070000e-30 143.0
8 TraesCS2B01G612800 chr2B 78.505 214 42 3 103 313 212183045 212182833 1.890000e-28 137.0
9 TraesCS2B01G612800 chr4D 82.521 698 76 16 4 662 494059513 494058823 4.380000e-159 571.0
10 TraesCS2B01G612800 chr4D 80.693 202 34 4 10 207 7913248 7913048 6.760000e-33 152.0
11 TraesCS2B01G612800 chr6A 79.129 551 68 18 1 512 597696602 597697144 1.740000e-88 337.0
12 TraesCS2B01G612800 chr2D 76.632 475 81 21 1477 1946 584530851 584531300 6.520000e-58 235.0
13 TraesCS2B01G612800 chr2D 76.842 380 65 15 1019 1394 584539434 584539794 3.980000e-45 193.0
14 TraesCS2B01G612800 chr2D 75.306 409 72 17 994 1394 584533241 584533628 6.710000e-38 169.0
15 TraesCS2B01G612800 chr2D 79.039 229 43 4 2447 2674 584540566 584540790 6.760000e-33 152.0
16 TraesCS2B01G612800 chr7B 78.302 318 60 7 3 313 607524308 607523993 3.080000e-46 196.0
17 TraesCS2B01G612800 chr2A 80.913 241 44 2 2437 2675 718575720 718575960 5.150000e-44 189.0
18 TraesCS2B01G612800 chr2A 78.947 228 41 6 2447 2672 718722823 718723045 8.740000e-32 148.0
19 TraesCS2B01G612800 chr1B 92.453 106 7 1 3800 3904 12086029 12086134 2.430000e-32 150.0
20 TraesCS2B01G612800 chr1B 91.346 104 8 1 3802 3904 12078891 12078994 1.460000e-29 141.0
21 TraesCS2B01G612800 chr1B 91.346 104 8 1 3802 3904 12084053 12083950 1.460000e-29 141.0
22 TraesCS2B01G612800 chr1B 90.385 104 9 1 3802 3904 12049531 12049634 6.800000e-28 135.0
23 TraesCS2B01G612800 chr1B 90.385 104 9 1 3802 3904 12057800 12057903 6.800000e-28 135.0
24 TraesCS2B01G612800 chr1B 90.385 104 9 1 3802 3904 12061195 12061298 6.800000e-28 135.0
25 TraesCS2B01G612800 chr1B 76.033 121 27 2 3091 3210 532484882 532485001 1.170000e-05 62.1
26 TraesCS2B01G612800 chr5A 81.283 187 27 6 666 850 433189284 433189104 1.130000e-30 145.0
27 TraesCS2B01G612800 chr4A 80.952 189 28 6 664 850 328252982 328252800 4.070000e-30 143.0
28 TraesCS2B01G612800 chr3B 91.262 103 8 1 3803 3904 771664024 771663922 5.260000e-29 139.0
29 TraesCS2B01G612800 chr3B 84.906 106 16 0 745 850 578627333 578627228 1.480000e-19 108.0
30 TraesCS2B01G612800 chr7D 78.261 207 40 4 4 207 415792540 415792744 1.140000e-25 128.0
31 TraesCS2B01G612800 chr1A 86.792 106 14 0 745 850 570128160 570128055 6.850000e-23 119.0
32 TraesCS2B01G612800 chrUn 83.654 104 16 1 67 169 68151722 68151619 3.210000e-16 97.1
33 TraesCS2B01G612800 chr1D 71.161 534 112 27 3052 3581 232139657 232140152 1.150000e-15 95.3
34 TraesCS2B01G612800 chr1D 92.000 50 4 0 745 794 479209182 479209231 1.950000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G612800 chr2B 792039800 792043703 3903 False 3221.0 3642 100.000 1 3904 2 chr2B.!!$F5 3903
1 TraesCS2B01G612800 chr2B 791956050 791960299 4249 False 3175.0 3592 99.541 1 3904 2 chr2B.!!$F3 3903
2 TraesCS2B01G612800 chr2B 791980479 791981101 622 False 543.5 909 98.363 3209 3904 2 chr2B.!!$F4 695
3 TraesCS2B01G612800 chr4D 494058823 494059513 690 True 571.0 571 82.521 4 662 1 chr4D.!!$R2 658
4 TraesCS2B01G612800 chr6A 597696602 597697144 542 False 337.0 337 79.129 1 512 1 chr6A.!!$F1 511
5 TraesCS2B01G612800 chr2D 584530851 584533628 2777 False 202.0 235 75.969 994 1946 2 chr2D.!!$F1 952

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
513 552 0.040204 CAGCCTCCCAACCCATTCTT 59.96 55.0 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3308 4190 7.952671 TGGATAATTAAGAGAAGCGTAGATGT 58.047 34.615 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
247 251 3.454371 ACACAGACTGGAACTACACAC 57.546 47.619 7.51 0.00 0.00 3.82
513 552 0.040204 CAGCCTCCCAACCCATTCTT 59.960 55.000 0.00 0.00 0.00 2.52
553 592 0.999406 AAATTGTCGACGCCATCTCG 59.001 50.000 11.62 0.00 0.00 4.04
695 734 2.351418 CCCACACGTGTATTGTATGCTG 59.649 50.000 22.90 4.62 0.00 4.41
1215 1254 4.450976 TCCGGTGATGATTTGAGTTATGG 58.549 43.478 0.00 0.00 0.00 2.74
1302 1341 2.525629 TGTGCGGACCTGGAGGAA 60.526 61.111 4.04 0.00 38.94 3.36
3100 3866 8.289618 TGTTAAAGTTTACATGCTGCTTAAGAG 58.710 33.333 6.67 2.23 0.00 2.85
3308 4190 9.513906 TCATGTGTCAATAAATTGGTTCTTCTA 57.486 29.630 3.00 0.00 38.30 2.10
3389 4271 0.815734 TGAGGCCTTAGCACGACTAC 59.184 55.000 6.77 0.00 42.56 2.73
3390 4272 1.104630 GAGGCCTTAGCACGACTACT 58.895 55.000 6.77 0.00 42.56 2.57
3391 4273 1.477295 GAGGCCTTAGCACGACTACTT 59.523 52.381 6.77 0.00 42.56 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
111 114 2.046700 CCGCCCTCGCCAAACTAA 60.047 61.111 0.0 0.0 0.00 2.24
247 251 0.036952 AGTGAAGTCAGCACATCGGG 60.037 55.000 0.0 0.0 38.70 5.14
513 552 2.986979 TGTGTCCCGCTCTACGCA 60.987 61.111 0.0 0.0 41.76 5.24
553 592 1.708027 CCGAGAATGTTTCGACCGC 59.292 57.895 0.0 0.0 40.36 5.68
639 678 1.342496 CATAGGCTGCTTCAGATCCGA 59.658 52.381 0.0 0.0 32.44 4.55
1215 1254 2.353357 TGGCCATGTCATCTGGAATC 57.647 50.000 0.0 0.0 35.70 2.52
1302 1341 0.946221 CGTCGTCAAAGCTGCCTTCT 60.946 55.000 0.0 0.0 0.00 2.85
3308 4190 7.952671 TGGATAATTAAGAGAAGCGTAGATGT 58.047 34.615 0.0 0.0 0.00 3.06
3389 4271 7.611855 ACTTTGTTGGAGTAGATATTTGGGAAG 59.388 37.037 0.0 0.0 0.00 3.46
3390 4272 7.466804 ACTTTGTTGGAGTAGATATTTGGGAA 58.533 34.615 0.0 0.0 0.00 3.97
3391 4273 7.027874 ACTTTGTTGGAGTAGATATTTGGGA 57.972 36.000 0.0 0.0 0.00 4.37
3581 4466 9.350951 ACCATGCTAGTTATTATTTTAGGGAAC 57.649 33.333 0.0 0.0 0.00 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.