Multiple sequence alignment - TraesCS2B01G612700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G612700 chr2B 100.000 1972 0 0 1 1972 791956050 791958021 0.000000e+00 3642.0
1 TraesCS2B01G612700 chr2B 99.544 1972 9 0 1 1972 792039800 792041771 0.000000e+00 3592.0
2 TraesCS2B01G612700 chr2B 100.000 1516 0 0 2738 4253 791958787 791960302 0.000000e+00 2800.0
3 TraesCS2B01G612700 chr2B 99.539 1519 4 1 2738 4253 792042188 792043706 0.000000e+00 2763.0
4 TraesCS2B01G612700 chr2B 97.170 530 9 3 3558 4084 791980479 791981005 0.000000e+00 891.0
5 TraesCS2B01G612700 chr2B 96.377 276 8 2 3286 3561 791966111 791966384 1.800000e-123 453.0
6 TraesCS2B01G612700 chr2B 99.020 102 1 0 4152 4253 791981003 791981104 2.610000e-42 183.0
7 TraesCS2B01G612700 chr2B 79.439 214 40 3 103 313 212183045 212182833 9.530000e-32 148.0
8 TraesCS2B01G612700 chr2B 78.261 230 45 4 2796 3024 704292567 704292792 4.430000e-30 143.0
9 TraesCS2B01G612700 chr4D 83.095 698 72 16 4 662 494059513 494058823 1.020000e-165 593.0
10 TraesCS2B01G612700 chr4D 81.188 202 33 4 10 207 7913248 7913048 1.580000e-34 158.0
11 TraesCS2B01G612700 chr6A 79.459 555 67 19 1 516 597696602 597697148 2.430000e-92 350.0
12 TraesCS2B01G612700 chr2D 76.632 475 81 21 1477 1946 584530851 584531300 7.110000e-58 235.0
13 TraesCS2B01G612700 chr2D 76.316 380 67 15 1019 1394 584539434 584539794 9.390000e-42 182.0
14 TraesCS2B01G612700 chr2D 75.000 408 75 18 994 1394 584533241 584533628 3.400000e-36 163.0
15 TraesCS2B01G612700 chr2D 79.039 229 43 4 2796 3023 584540566 584540790 7.370000e-33 152.0
16 TraesCS2B01G612700 chr7B 78.302 318 60 7 3 313 607524308 607523993 3.350000e-46 196.0
17 TraesCS2B01G612700 chr2A 80.913 241 44 2 2786 3024 718575720 718575960 5.610000e-44 189.0
18 TraesCS2B01G612700 chr2A 78.947 228 41 6 2796 3021 718722823 718723045 9.530000e-32 148.0
19 TraesCS2B01G612700 chr1B 92.661 109 7 1 4146 4253 12086029 12086137 5.690000e-34 156.0
20 TraesCS2B01G612700 chr1B 91.589 107 8 1 4148 4253 12084053 12083947 3.430000e-31 147.0
21 TraesCS2B01G612700 chr1B 91.509 106 8 1 4148 4252 12078891 12078996 1.230000e-30 145.0
22 TraesCS2B01G612700 chr1B 90.654 107 9 1 4148 4253 12057800 12057906 1.590000e-29 141.0
23 TraesCS2B01G612700 chr1B 90.654 107 9 1 4148 4253 12061195 12061301 1.590000e-29 141.0
24 TraesCS2B01G612700 chr1B 90.566 106 9 1 4148 4252 12049531 12049636 5.730000e-29 139.0
25 TraesCS2B01G612700 chr1B 76.860 121 26 2 3440 3559 532484882 532485001 2.740000e-07 67.6
26 TraesCS2B01G612700 chr3B 91.509 106 8 1 4149 4253 771664024 771663919 1.230000e-30 145.0
27 TraesCS2B01G612700 chr3B 84.906 106 16 0 745 850 578627333 578627228 1.620000e-19 108.0
28 TraesCS2B01G612700 chr5A 80.749 187 28 6 666 850 433189284 433189104 5.730000e-29 139.0
29 TraesCS2B01G612700 chr4A 80.423 189 29 6 664 850 328252982 328252800 2.060000e-28 137.0
30 TraesCS2B01G612700 chr7D 78.744 207 39 4 4 207 415792540 415792744 2.670000e-27 134.0
31 TraesCS2B01G612700 chr1A 86.792 106 14 0 745 850 570128160 570128055 7.470000e-23 119.0
32 TraesCS2B01G612700 chrUn 84.615 104 15 1 67 169 68151722 68151619 7.520000e-18 102.0
33 TraesCS2B01G612700 chr1D 71.375 531 113 24 3401 3927 232139657 232140152 7.520000e-18 102.0
34 TraesCS2B01G612700 chr1D 92.000 50 4 0 745 794 479209182 479209231 2.120000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G612700 chr2B 791956050 791960302 4252 False 3221.0 3642 100.0000 1 4253 2 chr2B.!!$F3 4252
1 TraesCS2B01G612700 chr2B 792039800 792043706 3906 False 3177.5 3592 99.5415 1 4253 2 chr2B.!!$F5 4252
2 TraesCS2B01G612700 chr2B 791980479 791981104 625 False 537.0 891 98.0950 3558 4253 2 chr2B.!!$F4 695
3 TraesCS2B01G612700 chr4D 494058823 494059513 690 True 593.0 593 83.0950 4 662 1 chr4D.!!$R2 658
4 TraesCS2B01G612700 chr6A 597696602 597697148 546 False 350.0 350 79.4590 1 516 1 chr6A.!!$F1 515

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
536 575 0.888619 TAGAGCGGGACACACAGAAG 59.111 55.0 0.0 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3927 3969 9.930158 ACCATGCTAGTTATTATTTTAGGGAAA 57.07 29.63 0.0 0.0 0.0 3.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
536 575 0.888619 TAGAGCGGGACACACAGAAG 59.111 55.000 0.00 0.0 0.00 2.85
695 734 2.607635 CCCACACGTGTATTGTATGCTC 59.392 50.000 22.90 0.0 0.00 4.26
1215 1254 3.876914 TCCGGTGATGATTTGAGTTATGC 59.123 43.478 0.00 0.0 0.00 3.14
1302 1341 2.997315 TGTGCGGACCTGGAGGAG 60.997 66.667 4.04 0.0 38.94 3.69
3449 3488 8.625651 TGTTAAAGTTTACATGCTGCTTAAGAA 58.374 29.630 6.67 0.0 0.00 2.52
3868 3910 6.092807 GTGGTCTCCAGAACTGAATGAAATAC 59.907 42.308 3.19 0.0 32.34 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
536 575 1.810030 GGGAGATGGCGTCGACAAC 60.810 63.158 17.16 1.27 0.0 3.32
1215 1254 2.061509 TGGCCATGTCATCTGGAATG 57.938 50.000 0.00 0.00 35.7 2.67
1302 1341 1.869690 GTCGTCAAAGCTGCCTTCC 59.130 57.895 0.00 0.00 0.0 3.46
3927 3969 9.930158 ACCATGCTAGTTATTATTTTAGGGAAA 57.070 29.630 0.00 0.00 0.0 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.