Multiple sequence alignment - TraesCS2B01G612500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G612500 chr2B 100.000 2837 0 0 1 2837 791854106 791856942 0 5240
1 TraesCS2B01G612500 chr2B 98.345 2840 40 5 1 2837 791884166 791881331 0 4977
2 TraesCS2B01G612500 chr2B 98.243 2845 42 2 1 2837 791908651 791911495 0 4970
3 TraesCS2B01G612500 chr2B 98.204 2839 46 4 1 2837 791877748 791874913 0 4955
4 TraesCS2B01G612500 chr5A 98.662 2839 34 3 1 2837 21853806 21856642 0 5029
5 TraesCS2B01G612500 chr6A 98.627 2840 35 4 1 2837 531357174 531354336 0 5025
6 TraesCS2B01G612500 chr7B 98.417 2843 39 4 1 2837 368080842 368078000 0 4996
7 TraesCS2B01G612500 chr4A 98.380 2840 40 5 1 2837 59258887 59256051 0 4985


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G612500 chr2B 791854106 791856942 2836 False 5240 5240 100.0000 1 2837 1 chr2B.!!$F1 2836
1 TraesCS2B01G612500 chr2B 791908651 791911495 2844 False 4970 4970 98.2430 1 2837 1 chr2B.!!$F2 2836
2 TraesCS2B01G612500 chr2B 791874913 791884166 9253 True 4966 4977 98.2745 1 2837 2 chr2B.!!$R1 2836
3 TraesCS2B01G612500 chr5A 21853806 21856642 2836 False 5029 5029 98.6620 1 2837 1 chr5A.!!$F1 2836
4 TraesCS2B01G612500 chr6A 531354336 531357174 2838 True 5025 5025 98.6270 1 2837 1 chr6A.!!$R1 2836
5 TraesCS2B01G612500 chr7B 368078000 368080842 2842 True 4996 4996 98.4170 1 2837 1 chr7B.!!$R1 2836
6 TraesCS2B01G612500 chr4A 59256051 59258887 2836 True 4985 4985 98.3800 1 2837 1 chr4A.!!$R1 2836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
684 685 0.89553 TACTCTCCAAAGGCAGACGG 59.104 55.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2503 8940 0.455005 GGTGGTGGCTAGACTACGAC 59.545 60.0 0.0 1.01 37.68 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
556 557 3.825908 AAGGCCATCAAGGAAAAGGTA 57.174 42.857 5.01 0.0 41.22 3.08
684 685 0.895530 TACTCTCCAAAGGCAGACGG 59.104 55.000 0.00 0.0 0.00 4.79
695 696 3.004752 AGGCAGACGGAAAAATATGCT 57.995 42.857 0.00 0.0 33.55 3.79
705 706 7.013655 AGACGGAAAAATATGCTGATATGCTTT 59.986 33.333 0.00 0.0 0.00 3.51
882 883 8.870075 AATAGTAAGAAAAGCTCAACCAGAAT 57.130 30.769 0.00 0.0 0.00 2.40
953 954 5.852282 TTTTGAGCATATTAAGGGGAAGC 57.148 39.130 0.00 0.0 0.00 3.86
2120 8557 1.265568 GTACGCATACACTGACACGG 58.734 55.000 0.00 0.0 0.00 4.94
2181 8618 1.626321 TGAAGACCTGTATGGCCGAAA 59.374 47.619 0.00 0.0 40.22 3.46
2264 8701 7.536159 AGAAAGCAAAGATTCCTGAAGATTT 57.464 32.000 0.00 0.0 0.00 2.17
2402 8839 1.774217 ACCTTGAAGCCACCCCTCA 60.774 57.895 0.00 0.0 0.00 3.86
2409 8846 3.712907 GCCACCCCTCACGGCTAA 61.713 66.667 0.00 0.0 42.78 3.09
2503 8940 1.669115 CACCAGAGCACCACTTCCG 60.669 63.158 0.00 0.0 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
556 557 7.311046 GGCAATTCTAGGGGTTTTAAATTCCTT 60.311 37.037 8.98 4.27 0.00 3.36
705 706 9.995003 TTACCGTCTTTAATTTGTAACTTCCTA 57.005 29.630 0.00 0.00 0.00 2.94
882 883 6.381498 TGGTGTCTTCAAATAAGACCCATA 57.619 37.500 17.06 0.08 44.47 2.74
1245 1247 0.752054 CAACCTTTGCTGGCTTTGGA 59.248 50.000 0.00 0.00 0.00 3.53
2120 8557 3.356529 TCTTCAGCCTTCAAGAATCCC 57.643 47.619 0.00 0.00 0.00 3.85
2181 8618 2.902705 TTGTGTACCAGTCTTCGCTT 57.097 45.000 0.00 0.00 0.00 4.68
2264 8701 2.351447 CGAGAGAGTGCCGACAAGTTTA 60.351 50.000 0.00 0.00 0.00 2.01
2409 8846 0.606673 GAGCCCAGCGTCTCCTTTTT 60.607 55.000 0.00 0.00 0.00 1.94
2503 8940 0.455005 GGTGGTGGCTAGACTACGAC 59.545 60.000 0.00 1.01 37.68 4.34
2557 8994 5.010617 GGAAATTACCTTCAAACTCTTGGCA 59.989 40.000 0.00 0.00 33.01 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.